EMAIL THIS PAGE TO A FRIEND

GLDN

gliomedin

50 Gene Product Result for
Synonyms: CLOM COLM CRG-L2 CRGL2 UNC-112
UniProtKB ID: Q6ZMI3, Q6UXZ7, Q7Z359
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181789 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177350 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177350 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177350 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090331 MISSION® esiRNA esiRNA human GLDN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181789 Rosetta Predictions human pricing
NM_181382 Rosetta Predictions rat pricing
NM_177350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120092 predicted 1735
2 SASI_Hs01_00120094 predicted 1084
3 SASI_Hs01_00120095 predicted 1331
4 SASI_Hs01_00120096 predicted 980
5 SASI_Hs01_00120098 predicted 959
6 SASI_Hs01_00120099 predicted 1460
7 SASI_Hs01_00120100 predicted 1548
8 SASI_Hs02_00370393 predicted 1063
9 SASI_Hs02_00370394 predicted 1145
10 SASI_Hs02_00370395 predicted 1635
11 SASI_Hs01_00120093 predicted 1441
12 SASI_Hs01_00120097 predicted 1684
13 SASI_Hs01_00120101 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181382 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102721 predicted 1759
2 SASI_Rn01_00102722 predicted 1353
3 SASI_Rn02_00269725 predicted 1351
4 SASI_Rn01_00102723 predicted 832
5 SASI_Rn01_00102724 predicted 967
6 SASI_Rn01_00102725 predicted 1296
7 SASI_Rn02_00269726 predicted 1903
8 SASI_Rn01_00102726 predicted 1791
9 SASI_Rn02_00269727 predicted 1007
10 SASI_Rn01_00102727 predicted 385
11 SASI_Rn01_00102728 predicted 1625
12 SASI_Rn01_00102729 predicted 1054
13 SASI_Rn01_00102730 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178109 predicted 1470
2 SASI_Mm01_00178110 predicted 919
3 SASI_Mm01_00178112 predicted 1538
4 SASI_Mm01_00178113 predicted 577
5 SASI_Mm01_00178114 predicted 1144
6 SASI_Mm01_00178115 predicted 301
7 SASI_Mm01_00178116 predicted 855
8 SASI_Mm01_00178117 predicted 669
9 SASI_Mm01_00178118 predicted 1507
10 SASI_Mm02_00347480 predicted 1293
11 SASI_Mm01_00178111 predicted 1206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181789
GLDN MISSION shRNA Bacterial Glycerol Stock
gliomedin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181789.2-1256s21c1
Sequence:CCGGATCCACCTTCCATACTATTTCCTCGAGGAAATAGTATGGAAGGTGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181789.2-1903s21c1
Sequence:CCGGTTTAACGTCAGCCAGATATTTCTCGAGAAATATCTGGCTGACGTTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181789.1-583s1c1
Sequence:CCGGCCATGATCACTTCCATTGGAACTCGAGTTCCAATGGAAGTGATCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151291    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181789.1-2959s1c1
Sequence:CCGGCCAGGGCAAATCTTATGTAAACTCGAGTTTACATAAGATTTGCCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181789.1-2274s1c1
Sequence:CCGGGCTGTGTAAGTAGACGTTAATCTCGAGATTAACGTCTACTTACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181789.1-1626s1c1
Sequence:CCGGCCTGTAGGTAATTTGGTGATTCTCGAGAATCACCAAATTACCTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181789.1-1177s1c1
Sequence:CCGGGAGGGAAACAGATCAATGCAACTCGAGTTGCATTGATCTGTTTCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181789.1-1138s1c1
Sequence:CCGGCCAAAGATATGAGGGTCACATCTCGAGATGTGACCCTCATATCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181789.1-703s1c1
Sequence:CCGGCAGGCATCATGGTTAAGGAATCTCGAGATTCCTTAACCATGATGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181789
GLDN MISSION shRNA shRNA Plasmid DNA
gliomedin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181789.2-1256s21c1
Sequence:CCGGATCCACCTTCCATACTATTTCCTCGAGGAAATAGTATGGAAGGTGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181789.2-1903s21c1
Sequence:CCGGTTTAACGTCAGCCAGATATTTCTCGAGAAATATCTGGCTGACGTTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181789.1-583s1c1
Sequence:CCGGCCATGATCACTTCCATTGGAACTCGAGTTCCAATGGAAGTGATCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151291    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181789.1-2959s1c1
Sequence:CCGGCCAGGGCAAATCTTATGTAAACTCGAGTTTACATAAGATTTGCCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181789.1-2274s1c1
Sequence:CCGGGCTGTGTAAGTAGACGTTAATCTCGAGATTAACGTCTACTTACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181789.1-1626s1c1
Sequence:CCGGCCTGTAGGTAATTTGGTGATTCTCGAGAATCACCAAATTACCTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181789.1-1177s1c1
Sequence:CCGGGAGGGAAACAGATCAATGCAACTCGAGTTGCATTGATCTGTTTCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181789.1-1138s1c1
Sequence:CCGGCCAAAGATATGAGGGTCACATCTCGAGATGTGACCCTCATATCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181789.1-703s1c1
Sequence:CCGGCAGGCATCATGGTTAAGGAATCTCGAGATTCCTTAACCATGATGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181789
GLDN MISSION shRNA Lentiviral Transduction Particles
gliomedin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181789.2-1256s21c1
Sequence:CCGGATCCACCTTCCATACTATTTCCTCGAGGAAATAGTATGGAAGGTGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181789.2-1903s21c1
Sequence:CCGGTTTAACGTCAGCCAGATATTTCTCGAGAAATATCTGGCTGACGTTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181789.1-583s1c1
Sequence:CCGGCCATGATCACTTCCATTGGAACTCGAGTTCCAATGGAAGTGATCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151291    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181789.1-2959s1c1
Sequence:CCGGCCAGGGCAAATCTTATGTAAACTCGAGTTTACATAAGATTTGCCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181789.1-2274s1c1
Sequence:CCGGGCTGTGTAAGTAGACGTTAATCTCGAGATTAACGTCTACTTACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181789.1-1626s1c1
Sequence:CCGGCCTGTAGGTAATTTGGTGATTCTCGAGAATCACCAAATTACCTACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181789.1-1177s1c1
Sequence:CCGGGAGGGAAACAGATCAATGCAACTCGAGTTGCATTGATCTGTTTCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181789.1-1138s1c1
Sequence:CCGGCCAAAGATATGAGGGTCACATCTCGAGATGTGACCCTCATATCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181789.1-703s1c1
Sequence:CCGGCAGGCATCATGGTTAAGGAATCTCGAGATTCCTTAACCATGATGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177350
GLDN MISSION shRNA Bacterial Glycerol Stock
gliomedin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177350.2-2372s1c1
Sequence:CCGGGCTGGGAAAGTAAACAGGATACTCGAGTATCCTGTTTACTTTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177350.2-1514s1c1
Sequence:CCGGCCTTTGATTTGTTAGGAGGAACTCGAGTTCCTCCTAACAAATCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177350.2-1515s1c1
Sequence:CCGGCTTTGATTTGTTAGGAGGAAACTCGAGTTTCCTCCTAACAAATCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177350.2-1328s1c1
Sequence:CCGGGCATCTGGATTATCTACGCTTCTCGAGAAGCGTAGATAATCCAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177350.2-898s1c1
Sequence:CCGGGAGAAAGCAAATGAACGCCATCTCGAGATGGCGTTCATTTGCTTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177350
GLDN MISSION shRNA shRNA Plasmid DNA
gliomedin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177350.2-2372s1c1
Sequence:CCGGGCTGGGAAAGTAAACAGGATACTCGAGTATCCTGTTTACTTTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177350.2-1514s1c1
Sequence:CCGGCCTTTGATTTGTTAGGAGGAACTCGAGTTCCTCCTAACAAATCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177350.2-1515s1c1
Sequence:CCGGCTTTGATTTGTTAGGAGGAAACTCGAGTTTCCTCCTAACAAATCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177350.2-1328s1c1
Sequence:CCGGGCATCTGGATTATCTACGCTTCTCGAGAAGCGTAGATAATCCAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177350.2-898s1c1
Sequence:CCGGGAGAAAGCAAATGAACGCCATCTCGAGATGGCGTTCATTTGCTTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177350
GLDN MISSION shRNA Lentiviral Transduction Particles
gliomedin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177350.2-2372s1c1
Sequence:CCGGGCTGGGAAAGTAAACAGGATACTCGAGTATCCTGTTTACTTTCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177350.2-1514s1c1
Sequence:CCGGCCTTTGATTTGTTAGGAGGAACTCGAGTTCCTCCTAACAAATCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177350.2-1515s1c1
Sequence:CCGGCTTTGATTTGTTAGGAGGAAACTCGAGTTTCCTCCTAACAAATCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177350.2-1328s1c1
Sequence:CCGGGCATCTGGATTATCTACGCTTCTCGAGAAGCGTAGATAATCCAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177350.2-898s1c1
Sequence:CCGGGAGAAAGCAAATGAACGCCATCTCGAGATGGCGTTCATTTGCTTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)