EMAIL THIS PAGE TO A FRIEND

GLE1

GLE1 RNA export mediator

76 Gene Product Result for
Synonyms: GLE1L LCCS LCCS1 hGLE1
UniProtKB ID: Q53GS7, O75458, Q53GT9, Q5VVU1, Q8NCP6, Q9UFL6
Gene ID:
Human(2733) Summary: This gene encodes a predicted 75-kDa polypeptide with high sequence and structure homology to yeast Gle1p, which is nuclear protein with a leucine-rich nuclear export sequence essential for poly(A)+RNA export. Inhibition of human GLE1L by microinjection of antibodies against GLE1L in HeLa cells resulted in inhibition of poly(A)+RNA export. Immunoflourescence studies show that GLE1L is localized at the nuclear pore complexes. This localization suggests that GLE1L may act at a terminal step in the export of mature RNA messages to the cytoplasm. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(74412) GLE1 RNA export mediator (yeast)
Rat(362098) GLE1 RNA export mediator
Zebrafish(445408) GLE1 RNA export mediator homolog (yeast)
chicken(417212) GLE1 RNA export mediator
dog(480704) GLE1 RNA export mediator homolog (yeast)
cow(540982) GLE1 RNA export mediator homolog (yeast)
Horse(100066964) GLE1 RNA export mediator homolog (yeast)
domestic cat(101080492) GLE1 RNA export mediator homolog (yeast)
sheep(101119123) GLE1 RNA export mediator homolog (yeast)
domestic guinea pig(100732111) GLE1 RNA export mediator
naked mole-rat(101722063) GLE1 RNA export mediator homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028923 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028923 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028923 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001499 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001499 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001499 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU094431 MISSION® esiRNA esiRNA targeting mouse Gle1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003722 Rosetta Predictions human pricing
NM_001499 Rosetta Predictions human pricing
NM_001025731 Rosetta Predictions rat pricing
NM_028923 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089249 predicted 220
2 SASI_Hs02_00304366 predicted 1320
3 SASI_Hs01_00089250 predicted 1529
4 SASI_Hs01_00089251 predicted 347
5 SASI_Hs01_00089252 predicted 1687
6 SASI_Hs01_00089253 predicted 237
7 SASI_Hs01_00089254 predicted 451
8 SASI_Hs02_00304367 predicted 1755
9 SASI_Hs01_00089255 predicted 988
10 SASI_Hs01_00089257 predicted 601
11 SASI_Hs01_00089256 predicted 751
12 SASI_Hs01_00089258 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001499 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126825 predicted 225
2 SASI_Hs02_00331989 predicted 1317
3 SASI_Hs01_00126826 predicted 1532
4 SASI_Hs01_00126827 predicted 346
5 SASI_Hs01_00126828 predicted 1691
6 SASI_Hs01_00126829 predicted 242
7 SASI_Hs01_00126830 predicted 455
8 SASI_Hs02_00331990 predicted 1754
9 SASI_Hs01_00126831 predicted 982
10 SASI_Hs01_00126833 predicted 607
11 SASI_Hs01_00126832 predicted 748
12 SASI_Hs01_00126834 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033182 predicted 324
2 SASI_Rn01_00033183 predicted 1974
3 SASI_Rn01_00033184 predicted 247
4 SASI_Rn01_00033185 predicted 448
5 SASI_Rn01_00033188 predicted 1365
6 SASI_Rn01_00033189 predicted 1159
7 SASI_Rn01_00033190 predicted 1248
8 SASI_Rn02_00203365 predicted 702
9 SASI_Rn02_00203366 predicted 337
10 SASI_Rn02_00203367 predicted 453
11 SASI_Rn01_00033186 predicted 627
12 SASI_Rn01_00033187 predicted 844
13 SASI_Rn01_00033191 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028923 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143078 predicted 1997
2 SASI_Mm01_00143079 predicted 728
3 SASI_Mm01_00143073 predicted 467
4 SASI_Mm02_00334620 predicted 196
5 SASI_Mm01_00143074 predicted 944
6 SASI_Mm01_00143075 predicted 1314
7 SASI_Mm02_00334621 predicted 313
8 SASI_Mm01_00143076 predicted 473
9 SASI_Mm01_00143077 predicted 345
10 SASI_Mm02_00334622 predicted 1647
11 SASI_Mm01_00143072 predicted 1308
12 SASI_Mm01_00143080 predicted 2243
13 SASI_Mm01_00143081 predicted 2241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028923
VALIDATED
GLE1 MISSION shRNA Bacterial Glycerol Stock
GLE1 RNA export mediator
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028923.1-348s1c1
Sequence:CCGGCTGTCAGAAGTAGCCCACAATCTCGAGATTGTGGGCTACTTCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028923.1-224s1c1
Sequence:CCGGTGGGTGGTAGATCACATCCTACTCGAGTAGGATGTGATCTACCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028923.1-481s1c1
Sequence:CCGGGTACGAATTGGCGCACAGAATCTCGAGATTCTGTGCGCCAATTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028923.1-322s1c1
Sequence:CCGGGTACCAATCCTCACTACTAAACTCGAGTTTAGTAGTGAGGATTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028923.2-470s21c1
Sequence:CCGGTGCATCCGAATGTACGAATTGCTCGAGCAATTCGTACATTCGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028923.2-372s21c1
Sequence:CCGGCGTCACCCTCATCACCAAATGCTCGAGCATTTGGTGATGAGGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028923.2-322s21c1
Sequence:CCGGGTACCAATCCTCACTACTAAACTCGAGTTTAGTAGTGAGGATTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028923.2-604s21c1
Sequence:CCGGGAAGGAGCTGAAGCTGCATAACTCGAGTTATGCAGCTTCAGCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028923.2-1702s21c1
Sequence:CCGGGGCCTTGGAGGACTATCAAAGCTCGAGCTTTGATAGTCCTCCAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028923
VALIDATED
GLE1 MISSION shRNA shRNA Plasmid DNA
GLE1 RNA export mediator
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028923.1-348s1c1
Sequence:CCGGCTGTCAGAAGTAGCCCACAATCTCGAGATTGTGGGCTACTTCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028923.1-224s1c1
Sequence:CCGGTGGGTGGTAGATCACATCCTACTCGAGTAGGATGTGATCTACCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028923.1-481s1c1
Sequence:CCGGGTACGAATTGGCGCACAGAATCTCGAGATTCTGTGCGCCAATTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028923.1-322s1c1
Sequence:CCGGGTACCAATCCTCACTACTAAACTCGAGTTTAGTAGTGAGGATTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028923.2-470s21c1
Sequence:CCGGTGCATCCGAATGTACGAATTGCTCGAGCAATTCGTACATTCGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028923.2-372s21c1
Sequence:CCGGCGTCACCCTCATCACCAAATGCTCGAGCATTTGGTGATGAGGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028923.2-322s21c1
Sequence:CCGGGTACCAATCCTCACTACTAAACTCGAGTTTAGTAGTGAGGATTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028923.2-604s21c1
Sequence:CCGGGAAGGAGCTGAAGCTGCATAACTCGAGTTATGCAGCTTCAGCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028923.2-1702s21c1
Sequence:CCGGGGCCTTGGAGGACTATCAAAGCTCGAGCTTTGATAGTCCTCCAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028923
VALIDATED
GLE1 MISSION shRNA Lentiviral Transduction Particles
GLE1 RNA export mediator
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028923.1-348s1c1
Sequence:CCGGCTGTCAGAAGTAGCCCACAATCTCGAGATTGTGGGCTACTTCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028923.1-224s1c1
Sequence:CCGGTGGGTGGTAGATCACATCCTACTCGAGTAGGATGTGATCTACCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028923.1-481s1c1
Sequence:CCGGGTACGAATTGGCGCACAGAATCTCGAGATTCTGTGCGCCAATTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028923.1-322s1c1
Sequence:CCGGGTACCAATCCTCACTACTAAACTCGAGTTTAGTAGTGAGGATTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028923.2-470s21c1
Sequence:CCGGTGCATCCGAATGTACGAATTGCTCGAGCAATTCGTACATTCGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028923.2-372s21c1
Sequence:CCGGCGTCACCCTCATCACCAAATGCTCGAGCATTTGGTGATGAGGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028923.2-322s21c1
Sequence:CCGGGTACCAATCCTCACTACTAAACTCGAGTTTAGTAGTGAGGATTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028923.2-604s21c1
Sequence:CCGGGAAGGAGCTGAAGCTGCATAACTCGAGTTATGCAGCTTCAGCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028923.2-1702s21c1
Sequence:CCGGGGCCTTGGAGGACTATCAAAGCTCGAGCTTTGATAGTCCTCCAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001499
GLE1 MISSION shRNA Bacterial Glycerol Stock
GLE1 RNA export mediator
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001499.2-2114s1c1
Sequence:CCGGGTAACTCATAACCAGGCCTCACTCGAGTGAGGCCTGGTTATGAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001499.2-346s1c1
Sequence:CCGGGCCCTAGATCAACCCTCATTTCTCGAGAAATGAGGGTTGATCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001499.2-1666s1c1
Sequence:CCGGGACCTCATTCTTGCTCATCTACTCGAGTAGATGAGCAAGAATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001499.2-610s1c1
Sequence:CCGGTCTGAACAACTGAAGCGGTTTCTCGAGAAACCGCTTCAGTTGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001499.2-2053s1c1
Sequence:CCGGCTCATCAAAGAGGACTACTTTCTCGAGAAAGTAGTCCTCTTTGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001499.2-2114s21c1
Sequence:CCGGGTAACTCATAACCAGGCCTCACTCGAGTGAGGCCTGGTTATGAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001499.2-1666s21c1
Sequence:CCGGGACCTCATTCTTGCTCATCTACTCGAGTAGATGAGCAAGAATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001499.2-610s21c1
Sequence:CCGGTCTGAACAACTGAAGCGGTTTCTCGAGAAACCGCTTCAGTTGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001499.2-346s21c1
Sequence:CCGGGCCCTAGATCAACCCTCATTTCTCGAGAAATGAGGGTTGATCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001499
GLE1 MISSION shRNA shRNA Plasmid DNA
GLE1 RNA export mediator
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001499.2-2114s1c1
Sequence:CCGGGTAACTCATAACCAGGCCTCACTCGAGTGAGGCCTGGTTATGAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001499.2-346s1c1
Sequence:CCGGGCCCTAGATCAACCCTCATTTCTCGAGAAATGAGGGTTGATCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001499.2-1666s1c1
Sequence:CCGGGACCTCATTCTTGCTCATCTACTCGAGTAGATGAGCAAGAATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001499.2-610s1c1
Sequence:CCGGTCTGAACAACTGAAGCGGTTTCTCGAGAAACCGCTTCAGTTGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001499.2-2053s1c1
Sequence:CCGGCTCATCAAAGAGGACTACTTTCTCGAGAAAGTAGTCCTCTTTGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001499.2-2114s21c1
Sequence:CCGGGTAACTCATAACCAGGCCTCACTCGAGTGAGGCCTGGTTATGAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001499.2-1666s21c1
Sequence:CCGGGACCTCATTCTTGCTCATCTACTCGAGTAGATGAGCAAGAATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001499.2-610s21c1
Sequence:CCGGTCTGAACAACTGAAGCGGTTTCTCGAGAAACCGCTTCAGTTGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001499.2-346s21c1
Sequence:CCGGGCCCTAGATCAACCCTCATTTCTCGAGAAATGAGGGTTGATCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001499
GLE1 MISSION shRNA Lentiviral Transduction Particles
GLE1 RNA export mediator
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001499.2-2114s1c1
Sequence:CCGGGTAACTCATAACCAGGCCTCACTCGAGTGAGGCCTGGTTATGAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001499.2-346s1c1
Sequence:CCGGGCCCTAGATCAACCCTCATTTCTCGAGAAATGAGGGTTGATCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001499.2-1666s1c1
Sequence:CCGGGACCTCATTCTTGCTCATCTACTCGAGTAGATGAGCAAGAATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001499.2-610s1c1
Sequence:CCGGTCTGAACAACTGAAGCGGTTTCTCGAGAAACCGCTTCAGTTGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001499.2-2053s1c1
Sequence:CCGGCTCATCAAAGAGGACTACTTTCTCGAGAAAGTAGTCCTCTTTGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001499.2-2114s21c1
Sequence:CCGGGTAACTCATAACCAGGCCTCACTCGAGTGAGGCCTGGTTATGAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001499.2-1666s21c1
Sequence:CCGGGACCTCATTCTTGCTCATCTACTCGAGTAGATGAGCAAGAATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001499.2-610s21c1
Sequence:CCGGTCTGAACAACTGAAGCGGTTTCTCGAGAAACCGCTTCAGTTGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001499.2-346s21c1
Sequence:CCGGGCCCTAGATCAACCCTCATTTCTCGAGAAATGAGGGTTGATCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks