EMAIL THIS PAGE TO A FRIEND

GLG1

golgi glycoprotein 1

77 Gene Product Result for
Synonyms: CFR-1 ESL-1 MG-160 MG160
UniProtKB ID: Q92896, B7Z8Y4, D3DUJ7, Q13221, Q6P9D1
Gene ID:
Mouse(20340) golgi apparatus protein 1
Rat(29476) golgi glycoprotein 1
fruit fly(40382) Golgi complex-localized glycoprotein 1
Horse(100055066) golgi glycoprotein 1
domestic cat(101095628) golgi glycoprotein 1
dog(479654) golgi glycoprotein 1
cow(281196) golgi glycoprotein 1
chicken(396492) golgi glycoprotein 1
domestic guinea pig(100716554) golgi glycoprotein 1
naked mole-rat(101714817) golgi glycoprotein 1
sheep(101116167) golgi glycoprotein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012201 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012201 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012201 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009149 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009149 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009149 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012201 Rosetta Predictions human pricing
NM_017211 Rosetta Predictions rat pricing
NM_009149 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118976 predicted 524
2 SASI_Hs01_00118978 predicted 1101
3 SASI_Hs01_00118979 predicted 1925
4 SASI_Hs01_00118980 predicted 872
5 SASI_Hs01_00118981 predicted 2973
6 SASI_Hs02_00343851 predicted 1308
7 SASI_Hs01_00118982 predicted 3332
8 SASI_Hs02_00343852 predicted 1764
9 SASI_Hs02_00343853 predicted 562
10 SASI_Hs01_00118984 predicted 2108
11 SASI_Hs01_00118977 predicted 2068
12 SASI_Hs01_00118983 predicted 2143
13 SASI_Hs01_00118985 predicted 1535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086868 predicted 1068
2 SASI_Rn01_00086869 predicted 2074
3 SASI_Rn01_00086870 predicted 2794
4 SASI_Rn02_00261572 predicted 482
5 SASI_Rn02_00261573 predicted 623
6 SASI_Rn01_00086871 predicted 2555
7 SASI_Rn01_00086872 predicted 515
8 SASI_Rn01_00086873 predicted 3470
9 SASI_Rn01_00086875 predicted 1504
10 SASI_Rn01_00086876 predicted 2129
11 SASI_Rn01_00086874 predicted 3557
12 SASI_Rn01_00086877 predicted 3712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138091 predicted 2885
2 SASI_Mm01_00138092 predicted 630
3 SASI_Mm01_00138093 predicted 1065
4 SASI_Mm01_00138094 predicted 1341
5 SASI_Mm01_00138095 predicted 722
6 SASI_Mm01_00138096 predicted 1571
7 SASI_Mm01_00138097 predicted 3024
8 SASI_Mm01_00138098 predicted 2796
9 SASI_Mm01_00138099 predicted 2473
10 SASI_Mm01_00138100 predicted 1102
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012201
VALIDATED
GLG1 MISSION shRNA Bacterial Glycerol Stock
golgi glycoprotein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012201.5-2498s21c1
Sequence:CCGGCCGCTTGGAGCCAGATCTATACTCGAGTATAGATCTGGCTCCAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012201.5-3727s21c1
Sequence:CCGGGTGGAAAGTTATCACATTAAACTCGAGTTTAATGTGATAACTTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012201.5-3446s21c1
Sequence:CCGGTGATCTTGCCATGCAAGTAATCTCGAGATTACTTGCATGGCAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012201.5-712s21c1
Sequence:CCGGCCAAGATGACGGCCATCATTTCTCGAGAAATGATGGCCGTCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012201.5-582s21c1
Sequence:CCGGGAGGTTTGCAAATCTACTATACTCGAGTATAGTAGATTTGCAAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012201.5-4029s21c1
Sequence:CCGGTACAGTAGGAGAGACATTTATCTCGAGATAAATGTCTCTCCTACTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012201.1-2050s1c1
Sequence:CCGGGCAACCTCACTGAGTTAGAATCTCGAGATTCTAACTCAGTGAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012201.1-2842s1c1
Sequence:CCGGCCTGTAAAGCTGACATTCCTACTCGAGTAGGAATGTCAGCTTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_012201.1-870s1c1
Sequence:CCGGCCCAAGATTCAAGTTTCTGAACTCGAGTTCAGAAACTTGAATCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012201.1-716s1c1
Sequence:CCGGCCGTTTAATCTGTGGCTTCATCTCGAGATGAAGCCACAGATTAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_012201.1-2973s1c1
Sequence:CCGGGAAGACCAGATCCGAATCATTCTCGAGAATGATTCGGATCTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012201
VALIDATED
GLG1 MISSION shRNA shRNA Plasmid DNA
golgi glycoprotein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012201.5-2498s21c1
Sequence:CCGGCCGCTTGGAGCCAGATCTATACTCGAGTATAGATCTGGCTCCAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012201.5-3727s21c1
Sequence:CCGGGTGGAAAGTTATCACATTAAACTCGAGTTTAATGTGATAACTTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012201.5-3446s21c1
Sequence:CCGGTGATCTTGCCATGCAAGTAATCTCGAGATTACTTGCATGGCAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012201.5-712s21c1
Sequence:CCGGCCAAGATGACGGCCATCATTTCTCGAGAAATGATGGCCGTCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012201.5-582s21c1
Sequence:CCGGGAGGTTTGCAAATCTACTATACTCGAGTATAGTAGATTTGCAAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012201.5-4029s21c1
Sequence:CCGGTACAGTAGGAGAGACATTTATCTCGAGATAAATGTCTCTCCTACTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012201.1-2050s1c1
Sequence:CCGGGCAACCTCACTGAGTTAGAATCTCGAGATTCTAACTCAGTGAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012201.1-2842s1c1
Sequence:CCGGCCTGTAAAGCTGACATTCCTACTCGAGTAGGAATGTCAGCTTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_012201.1-870s1c1
Sequence:CCGGCCCAAGATTCAAGTTTCTGAACTCGAGTTCAGAAACTTGAATCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012201.1-716s1c1
Sequence:CCGGCCGTTTAATCTGTGGCTTCATCTCGAGATGAAGCCACAGATTAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_012201.1-2973s1c1
Sequence:CCGGGAAGACCAGATCCGAATCATTCTCGAGAATGATTCGGATCTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012201
VALIDATED
GLG1 MISSION shRNA Lentiviral Transduction Particles
golgi glycoprotein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012201.5-2498s21c1
Sequence:CCGGCCGCTTGGAGCCAGATCTATACTCGAGTATAGATCTGGCTCCAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012201.5-3727s21c1
Sequence:CCGGGTGGAAAGTTATCACATTAAACTCGAGTTTAATGTGATAACTTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012201.5-3446s21c1
Sequence:CCGGTGATCTTGCCATGCAAGTAATCTCGAGATTACTTGCATGGCAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012201.5-712s21c1
Sequence:CCGGCCAAGATGACGGCCATCATTTCTCGAGAAATGATGGCCGTCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012201.5-582s21c1
Sequence:CCGGGAGGTTTGCAAATCTACTATACTCGAGTATAGTAGATTTGCAAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012201.5-4029s21c1
Sequence:CCGGTACAGTAGGAGAGACATTTATCTCGAGATAAATGTCTCTCCTACTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012201.1-2050s1c1
Sequence:CCGGGCAACCTCACTGAGTTAGAATCTCGAGATTCTAACTCAGTGAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012201.1-2842s1c1
Sequence:CCGGCCTGTAAAGCTGACATTCCTACTCGAGTAGGAATGTCAGCTTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_012201.1-870s1c1
Sequence:CCGGCCCAAGATTCAAGTTTCTGAACTCGAGTTCAGAAACTTGAATCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012201.1-716s1c1
Sequence:CCGGCCGTTTAATCTGTGGCTTCATCTCGAGATGAAGCCACAGATTAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_012201.1-2973s1c1
Sequence:CCGGGAAGACCAGATCCGAATCATTCTCGAGAATGATTCGGATCTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009149
VALIDATED
GLG1 MISSION shRNA Bacterial Glycerol Stock
golgi glycoprotein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009149.2-2033s21c1
Sequence:CCGGAGTTAGAGTCCGAGGATATACCTCGAGGTATATCCTCGGACTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009149.2-991s21c1
Sequence:CCGGAGAGTGTATAAATGCCTATTTCTCGAGAAATAGGCATTTATACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009149.2-1074s21c1
Sequence:CCGGGCTCATTGCCCAGGATTATAACTCGAGTTATAATCCTGGGCAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009149.2-538s21c1
Sequence:CCGGTCAACTATTTCCGAGATTAAACTCGAGTTTAATCTCGGAAATAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317107    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009149.2-3581s21c1
Sequence:CCGGACAGCCGTCCTGTATAGTGTACTCGAGTACACTATACAGGACGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009149.1-3581s1c1
Sequence:CCGGACAGCCGTCCTGTATAGTGTACTCGAGTACACTATACAGGACGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009149.1-2889s1c1
Sequence:CCGGCCAAGTTATCTCATGCCTCAACTCGAGTTGAGGCATGAGATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009149.1-1083s1c1
Sequence:CCGGCCAGGATTATAAAGTCAGTTACTCGAGTAACTGACTTTATAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009149.1-616s1c1
Sequence:CCGGCGAGGCAACATCACTGAGTATCTCGAGATACTCAGTGATGTTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009149.1-1627s1c1
Sequence:CCGGCGGCTCTTAGAGCTACAGTATCTCGAGATACTGTAGCTCTAAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009149
VALIDATED
GLG1 MISSION shRNA shRNA Plasmid DNA
golgi glycoprotein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009149.2-2033s21c1
Sequence:CCGGAGTTAGAGTCCGAGGATATACCTCGAGGTATATCCTCGGACTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009149.2-991s21c1
Sequence:CCGGAGAGTGTATAAATGCCTATTTCTCGAGAAATAGGCATTTATACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009149.2-1074s21c1
Sequence:CCGGGCTCATTGCCCAGGATTATAACTCGAGTTATAATCCTGGGCAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009149.2-538s21c1
Sequence:CCGGTCAACTATTTCCGAGATTAAACTCGAGTTTAATCTCGGAAATAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317107    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009149.2-3581s21c1
Sequence:CCGGACAGCCGTCCTGTATAGTGTACTCGAGTACACTATACAGGACGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009149.1-3581s1c1
Sequence:CCGGACAGCCGTCCTGTATAGTGTACTCGAGTACACTATACAGGACGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009149.1-2889s1c1
Sequence:CCGGCCAAGTTATCTCATGCCTCAACTCGAGTTGAGGCATGAGATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009149.1-1083s1c1
Sequence:CCGGCCAGGATTATAAAGTCAGTTACTCGAGTAACTGACTTTATAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009149.1-616s1c1
Sequence:CCGGCGAGGCAACATCACTGAGTATCTCGAGATACTCAGTGATGTTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009149.1-1627s1c1
Sequence:CCGGCGGCTCTTAGAGCTACAGTATCTCGAGATACTGTAGCTCTAAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009149
VALIDATED
GLG1 MISSION shRNA Lentiviral Transduction Particles
golgi glycoprotein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009149.2-2033s21c1
Sequence:CCGGAGTTAGAGTCCGAGGATATACCTCGAGGTATATCCTCGGACTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009149.2-991s21c1
Sequence:CCGGAGAGTGTATAAATGCCTATTTCTCGAGAAATAGGCATTTATACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009149.2-1074s21c1
Sequence:CCGGGCTCATTGCCCAGGATTATAACTCGAGTTATAATCCTGGGCAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009149.2-538s21c1
Sequence:CCGGTCAACTATTTCCGAGATTAAACTCGAGTTTAATCTCGGAAATAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317107    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009149.2-3581s21c1
Sequence:CCGGACAGCCGTCCTGTATAGTGTACTCGAGTACACTATACAGGACGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009149.1-3581s1c1
Sequence:CCGGACAGCCGTCCTGTATAGTGTACTCGAGTACACTATACAGGACGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009149.1-2889s1c1
Sequence:CCGGCCAAGTTATCTCATGCCTCAACTCGAGTTGAGGCATGAGATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009149.1-1083s1c1
Sequence:CCGGCCAGGATTATAAAGTCAGTTACTCGAGTAACTGACTTTATAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009149.1-616s1c1
Sequence:CCGGCGAGGCAACATCACTGAGTATCTCGAGATACTCAGTGATGTTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009149.1-1627s1c1
Sequence:CCGGCGGCTCTTAGAGCTACAGTATCTCGAGATACTGTAGCTCTAAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks