EMAIL THIS PAGE TO A FRIEND

GLI1

GLI family zinc finger 1

73 Gene Product Result for
Synonyms: GLI
UniProtKB ID: P08151, D0EUY3, E9PQQ9, Q8TDN9
Gene ID:
Human(2735) Summary: This gene encodes a member of the Kruppel family of zinc finger proteins. The encoded transcription factor is activated by the sonic hedgehog signal transduction cascade and regulates stem cell proliferation. The activity and nuclear localization of this protein is negatively regulated by p53 in an inhibitory loop. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Mouse(14632) GLI-Kruppel family member GLI1
Rat(140589) GLI family zinc finger 1
Zebrafish(352930) GLI-Kruppel family member 1
cow(517588) GLI family zinc finger 1
Horse(100033937) GLI family zinc finger 1
domestic cat(101092697) GLI family zinc finger 1
dog(481126) GLI family zinc finger 1
chicken(396045) GLI family zinc finger 1
sheep(101120651) GLI family zinc finger 1
Domestic Rabbit(100358990) GLI family zinc finger 1
domestic guinea pig(100722656) GLI family zinc finger 1
naked mole-rat(101717488) GLI family zinc finger 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301901 Anti-GLI1 affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
AV32368 Anti-GLI1 (AB1) antibody produced in rabbit IgG fraction of antiserum mouse, horse, rabbit, canine, guinea pig, human, bovine
western blot pricing
AV100609 Anti-GLI1 (AB2) antibody produced in rabbit IgG fraction of antiserum canine, horse, guinea pig, rabbit, human, bovine
western blot pricing
SAB2700184 Anti-Gli1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
western blot pricing
SAB2700185 Anti-Gli1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
HPA065172 Anti-GLI1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0002735M1 Monoclonal Anti-GLI1 antibody produced in mouse clone 1F12, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1412712 Monoclonal Anti-GLI1 antibody produced in mouse clone 2C9, purified immunoglobulin, 1 mg/mL human
ELISA, western blot pricing
SAB1412713 Monoclonal Anti-GLI1 antibody produced in mouse clone 3C8, purified immunoglobulin, 1 mg/mL human
ELISA, immunofluorescence, western blot pricing
SAB1412714 Monoclonal Anti-GLI1 antibody produced in mouse clone 4F12, purified immunoglobulin, 1 mg/mL human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005269 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010296 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010296 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010296 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026341 MISSION® esiRNA esiRNA human GLI1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005269 Rosetta Predictions human pricing
XM_001056128 Rosetta Predictions rat pricing
XM_345832 Rosetta Predictions rat pricing
NM_010296 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148505 predicted 1002
2 SASI_Hs01_00148506 predicted 2245
3 SASI_Hs01_00148507 predicted 3009
4 SASI_Hs01_00148508 predicted 1198
5 SASI_Hs01_00148509 predicted 2837
6 SASI_Hs01_00148510 predicted 2889
7 SASI_Hs01_00148512 predicted 3149
8 SASI_Hs01_00148513 predicted 1126
9 SASI_Hs01_00148514 predicted 2773
10 SASI_Hs02_00339313 predicted 2737
11 SASI_Hs01_00148511 predicted 2170
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056128 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282139 predicted 3316
2 SASI_Rn02_00282140 predicted 2296
3 SASI_Rn02_00282141 predicted 1100
4 SASI_Rn02_00282142 predicted 1084
5 SASI_Rn02_00282143 predicted 2542
6 SASI_Rn02_00282144 predicted 487
7 SASI_Rn02_00282145 predicted 2394
8 SASI_Rn02_00282146 predicted 2036
9 SASI_Rn02_00282147 predicted 449
10 SASI_Rn02_00282148 predicted 1814
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345832 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398718 predicted 3318
2 SASI_Rn02_00398719 predicted 1221
3 SASI_Rn02_00398720 predicted 326
4 SASI_Rn02_00398721 predicted 1096
5 SASI_Rn02_00398722 predicted 1079
6 SASI_Rn02_00398723 predicted 630
7 SASI_Rn02_00398724 predicted 490
8 SASI_Rn02_00398725 predicted 389
9 SASI_Rn02_00398726 predicted 386
10 SASI_Rn02_00398727 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010296 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192102 predicted 3308
2 SASI_Mm01_00192103 predicted 1090
3 SASI_Mm01_00192104 predicted 2286
4 SASI_Mm01_00192105 predicted 3091
5 SASI_Mm01_00192106 predicted 1892
6 SASI_Mm01_00192107 predicted 1075
7 SASI_Mm01_00192108 predicted 620
8 SASI_Mm01_00192109 predicted 930
9 SASI_Mm01_00192110 predicted 1013
10 SASI_Mm01_00192111 predicted 2307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005269
GLI1 MISSION shRNA Bacterial Glycerol Stock
GLI family zinc finger 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005269.1-3414s1c1
Sequence:CCGGCATCCATCACAGATCGCATTTCTCGAGAAATGCGATCTGTGATGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005269.1-2761s1c1
Sequence:CCGGGCTCAGCTTGTGTGTAATTATCTCGAGATAATTACACACAAGCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005269.1-2686s1c1
Sequence:CCGGCCTGATTATCTTCCTTCAGAACTCGAGTTCTGAAGGAAGATAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005269.1-757s1c1
Sequence:CCGGCGTGAGCCTGAATCTGTGTATCTCGAGATACACAGATTCAGGCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005269.1-1187s1c1
Sequence:CCGGCCAAACGCTATACAGATCCTACTCGAGTAGGATCTGTATAGCGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005269.1-1595s21c1
Sequence:CCGGTACATCAACTCCGGCCAATAGCTCGAGCTATTGGCCGGAGTTGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005269.1-3414s21c1
Sequence:CCGGCATCCATCACAGATCGCATTTCTCGAGAAATGCGATCTGTGATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005269.1-1837s21c1
Sequence:CCGGTACCTGCTTCGGGCAAGATATCTCGAGATATCTTGCCCGAAGCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005269.1-1178s21c1
Sequence:CCGGCTGGCTGCACCAAACGCTATACTCGAGTATAGCGTTTGGTGCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005269.1-654s21c1
Sequence:CCGGGGAACCCTTGGAAGGTGATATCTCGAGATATCACCTTCCAAGGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005269
GLI1 MISSION shRNA shRNA Plasmid DNA
GLI family zinc finger 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005269.1-3414s1c1
Sequence:CCGGCATCCATCACAGATCGCATTTCTCGAGAAATGCGATCTGTGATGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005269.1-2761s1c1
Sequence:CCGGGCTCAGCTTGTGTGTAATTATCTCGAGATAATTACACACAAGCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005269.1-2686s1c1
Sequence:CCGGCCTGATTATCTTCCTTCAGAACTCGAGTTCTGAAGGAAGATAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005269.1-757s1c1
Sequence:CCGGCGTGAGCCTGAATCTGTGTATCTCGAGATACACAGATTCAGGCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005269.1-1187s1c1
Sequence:CCGGCCAAACGCTATACAGATCCTACTCGAGTAGGATCTGTATAGCGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005269.1-1595s21c1
Sequence:CCGGTACATCAACTCCGGCCAATAGCTCGAGCTATTGGCCGGAGTTGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005269.1-3414s21c1
Sequence:CCGGCATCCATCACAGATCGCATTTCTCGAGAAATGCGATCTGTGATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005269.1-1837s21c1
Sequence:CCGGTACCTGCTTCGGGCAAGATATCTCGAGATATCTTGCCCGAAGCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005269.1-1178s21c1
Sequence:CCGGCTGGCTGCACCAAACGCTATACTCGAGTATAGCGTTTGGTGCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005269.1-654s21c1
Sequence:CCGGGGAACCCTTGGAAGGTGATATCTCGAGATATCACCTTCCAAGGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005269
GLI1 MISSION shRNA Lentiviral Transduction Particles
GLI family zinc finger 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005269.1-3414s1c1
Sequence:CCGGCATCCATCACAGATCGCATTTCTCGAGAAATGCGATCTGTGATGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005269.1-2761s1c1
Sequence:CCGGGCTCAGCTTGTGTGTAATTATCTCGAGATAATTACACACAAGCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005269.1-2686s1c1
Sequence:CCGGCCTGATTATCTTCCTTCAGAACTCGAGTTCTGAAGGAAGATAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005269.1-757s1c1
Sequence:CCGGCGTGAGCCTGAATCTGTGTATCTCGAGATACACAGATTCAGGCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005269.1-1187s1c1
Sequence:CCGGCCAAACGCTATACAGATCCTACTCGAGTAGGATCTGTATAGCGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005269.1-1595s21c1
Sequence:CCGGTACATCAACTCCGGCCAATAGCTCGAGCTATTGGCCGGAGTTGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005269.1-3414s21c1
Sequence:CCGGCATCCATCACAGATCGCATTTCTCGAGAAATGCGATCTGTGATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005269.1-1837s21c1
Sequence:CCGGTACCTGCTTCGGGCAAGATATCTCGAGATATCTTGCCCGAAGCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005269.1-1178s21c1
Sequence:CCGGCTGGCTGCACCAAACGCTATACTCGAGTATAGCGTTTGGTGCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005269.1-654s21c1
Sequence:CCGGGGAACCCTTGGAAGGTGATATCTCGAGATATCACCTTCCAAGGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010296
GLI1 MISSION shRNA Bacterial Glycerol Stock
GLI family zinc finger 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010296.1-2473s1c1
Sequence:CCGGCCTATCCTGATCCACCAGAAACTCGAGTTTCTGGTGGATCAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010296.1-932s1c1
Sequence:CCGGCCACATCAACAGTGAGCATATCTCGAGATATGCTCACTGTTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010296.1-2571s1c1
Sequence:CCGGCGACTTGAGCATTATGGACAACTCGAGTTGTCCATAATGCTCAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010296.1-628s1c1
Sequence:CCGGCCTGTGTACCACATGACTCTACTCGAGTAGAGTCATGTGGTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010296.1-247s1c1
Sequence:CCGGGCATGGGAACAGAAGGACTTTCTCGAGAAAGTCCTTCTGTTCCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010296
GLI1 MISSION shRNA shRNA Plasmid DNA
GLI family zinc finger 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010296.1-2473s1c1
Sequence:CCGGCCTATCCTGATCCACCAGAAACTCGAGTTTCTGGTGGATCAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010296.1-932s1c1
Sequence:CCGGCCACATCAACAGTGAGCATATCTCGAGATATGCTCACTGTTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010296.1-2571s1c1
Sequence:CCGGCGACTTGAGCATTATGGACAACTCGAGTTGTCCATAATGCTCAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010296.1-628s1c1
Sequence:CCGGCCTGTGTACCACATGACTCTACTCGAGTAGAGTCATGTGGTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010296.1-247s1c1
Sequence:CCGGGCATGGGAACAGAAGGACTTTCTCGAGAAAGTCCTTCTGTTCCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010296
GLI1 MISSION shRNA Lentiviral Transduction Particles
GLI family zinc finger 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010296.1-2473s1c1
Sequence:CCGGCCTATCCTGATCCACCAGAAACTCGAGTTTCTGGTGGATCAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010296.1-932s1c1
Sequence:CCGGCCACATCAACAGTGAGCATATCTCGAGATATGCTCACTGTTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010296.1-2571s1c1
Sequence:CCGGCGACTTGAGCATTATGGACAACTCGAGTTGTCCATAATGCTCAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010296.1-628s1c1
Sequence:CCGGCCTGTGTACCACATGACTCTACTCGAGTAGAGTCATGTGGTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010296.1-247s1c1
Sequence:CCGGGCATGGGAACAGAAGGACTTTCTCGAGAAAGTCCTTCTGTTCCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks