EMAIL THIS PAGE TO A FRIEND

GLI2

GLI family zinc finger 2

66 Gene Product Result for
Synonyms: HPE9 THP1 THP2
Gene ID:
Human(2736) Summary: This gene encodes a protein which belongs to the C2H2-type zinc finger protein subclass of the Gli family. Members of this subclass are characterized as transcription factors which bind DNA through zinc finger motifs. These motifs contain conserved H-C links. Gli family zinc finger proteins are mediators of Sonic hedgehog (Shh) signaling and they are implicated as potent oncogenes in the embryonal carcinoma cell. The protein encoded by this gene localizes to the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. The encoded protein is associated with several phenotypes- Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
Mouse(14633) GLI-Kruppel family member GLI2
Rat(304729) GLI family zinc finger 2
domestic guinea pig(100715371) GLI family zinc finger 2
naked mole-rat(101697659) GLI family zinc finger 2
sheep(101114169) GLI family zinc finger 2
Domestic Rabbit(100359289) GLI family zinc finger 2
chicken(395956) GLI family zinc finger 2
dog(100682984) GLI family zinc finger 2
cow(510255) GLI family zinc finger 2
domestic cat(101101401) GLI family zinc finger 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005270 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081125 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081125 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081125 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030379 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005270 Rosetta Predictions human pricing
NM_001107169 Rosetta Predictions rat pricing
NM_001081125 Rosetta Predictions mouse pricing
XM_136212 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027717 predicted 4884
2 SASI_Hs01_00027718 predicted 375
3 SASI_Hs01_00027719 predicted 1801
4 SASI_Hs01_00027720 predicted 401
5 SASI_Hs01_00027722 predicted 400
6 SASI_Hs01_00027723 predicted 4721
7 SASI_Hs01_00027724 predicted 706
8 SASI_Hs01_00027725 predicted 1842
9 SASI_Hs02_00339314 predicted 3738
10 SASI_Hs02_00339315 predicted 1291
11 SASI_Hs01_00027716 predicted 5005
12 SASI_Hs01_00027721 predicted 1631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107169 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226185 predicted 1392
2 SASI_Rn02_00226186 predicted 3060
3 SASI_Rn02_00226187 predicted 1314
4 SASI_Rn02_00226188 predicted 2549
5 SASI_Rn02_00226189 predicted 1415
6 SASI_Rn02_00226190 predicted 1089
7 SASI_Rn02_00226191 predicted 2541
8 SASI_Rn02_00226192 predicted 4283
9 SASI_Rn02_00226193 predicted 387
10 SASI_Rn02_00226194 predicted 1587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081125 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295431 predicted 4818
2 SASI_Mm02_00295432 predicted 515
3 SASI_Mm02_00295433 predicted 4548
4 SASI_Mm02_00295434 predicted 3276
5 SASI_Mm02_00295435 predicted 3259
6 SASI_Mm02_00295436 predicted 2586
7 SASI_Mm02_00295437 predicted 3841
8 SASI_Mm02_00295438 predicted 3393
9 SASI_Mm02_00295439 predicted 4829
10 SASI_Mm02_00295440 predicted 1883
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_136212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276890 predicted 4821
2 SASI_Mm01_00276891 predicted 523
3 SASI_Mm01_00276892 predicted 4559
4 SASI_Mm01_00276893 predicted 3275
5 SASI_Mm01_00276894 predicted 4562
6 SASI_Mm01_00276895 predicted 3268
7 SASI_Mm01_00276896 predicted 2589
8 SASI_Mm01_00276897 predicted 3849
9 SASI_Mm01_00276898 predicted 3393
10 SASI_Mm01_00276899 predicted 4840
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005270
VALIDATED
GLI2 MISSION shRNA Bacterial Glycerol Stock
GLI family zinc finger 2
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000238362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005270.4-6490s21c1
Sequence:CCGGTGAGTCGTCCAGCCAAATTTACTCGAGTAAATTTGGCTGGACGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005270.4-246s21c1
Sequence:CCGGGTACCATTACGAGCCTCATTCCTCGAGGAATGAGGCTCGTAATGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005270.4-3733s21c1
Sequence:CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005270
VALIDATED
GLI2 MISSION shRNA shRNA Plasmid DNA
GLI family zinc finger 2
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000238362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005270.4-6490s21c1
Sequence:CCGGTGAGTCGTCCAGCCAAATTTACTCGAGTAAATTTGGCTGGACGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005270.4-246s21c1
Sequence:CCGGGTACCATTACGAGCCTCATTCCTCGAGGAATGAGGCTCGTAATGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005270.4-3733s21c1
Sequence:CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005270
VALIDATED
GLI2 MISSION shRNA Lentiviral Transduction Particles
GLI family zinc finger 2
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000238362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005270.4-6490s21c1
Sequence:CCGGTGAGTCGTCCAGCCAAATTTACTCGAGTAAATTTGGCTGGACGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005270.4-246s21c1
Sequence:CCGGGTACCATTACGAGCCTCATTCCTCGAGGAATGAGGCTCGTAATGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005270.4-3733s21c1
Sequence:CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081125
VALIDATED
GLI2 MISSION shRNA Bacterial Glycerol Stock
GLI family zinc finger 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081125.1-5815s21c1
Sequence:GTACCGGTATGTTTACCCGCTCCTATTTCTCGAGAAATAGGAGCGGGTAAACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081125.1-2206s21c1
Sequence:CCGGTGTGGAGGACTGCCTACATATCTCGAGATATGTAGGCAGTCCTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081125.1-1065s21c1
Sequence:CCGGTCGACCTACAACGCATGATTCCTCGAGGAATCATGCGTTGTAGGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081125.1-847s21c1
Sequence:CCGGCACCAACCCTTCAGACTATTACTCGAGTAATAGTCTGAAGGGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081125.1-628s21c1
Sequence:CCGGTATCTCCTTGATACGACTTTCCTCGAGGAAAGTCGTATCAAGGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081125
VALIDATED
GLI2 MISSION shRNA shRNA Plasmid DNA
GLI family zinc finger 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081125.1-5815s21c1
Sequence:GTACCGGTATGTTTACCCGCTCCTATTTCTCGAGAAATAGGAGCGGGTAAACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081125.1-2206s21c1
Sequence:CCGGTGTGGAGGACTGCCTACATATCTCGAGATATGTAGGCAGTCCTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081125.1-1065s21c1
Sequence:CCGGTCGACCTACAACGCATGATTCCTCGAGGAATCATGCGTTGTAGGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081125.1-847s21c1
Sequence:CCGGCACCAACCCTTCAGACTATTACTCGAGTAATAGTCTGAAGGGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081125.1-628s21c1
Sequence:CCGGTATCTCCTTGATACGACTTTCCTCGAGGAAAGTCGTATCAAGGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081125
VALIDATED
GLI2 MISSION shRNA Lentiviral Transduction Particles
GLI family zinc finger 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081125.1-5815s21c1
Sequence:GTACCGGTATGTTTACCCGCTCCTATTTCTCGAGAAATAGGAGCGGGTAAACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081125.1-2206s21c1
Sequence:CCGGTGTGGAGGACTGCCTACATATCTCGAGATATGTAGGCAGTCCTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081125.1-1065s21c1
Sequence:CCGGTCGACCTACAACGCATGATTCCTCGAGGAATCATGCGTTGTAGGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081125.1-847s21c1
Sequence:CCGGCACCAACCCTTCAGACTATTACTCGAGTAATAGTCTGAAGGGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081125.1-628s21c1
Sequence:CCGGTATCTCCTTGATACGACTTTCCTCGAGGAAAGTCGTATCAAGGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030379
VALIDATED
GLI2 MISSION shRNA Bacterial Glycerol Stock
GLI family zinc finger 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_030379.1-4376s1c1
Sequence:CCGGCCGCTTCAGATGACAGATGTTCTCGAGAACATCTGTCATCTGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_030379.1-4229s1c1
Sequence:CCGGGTTCCTGAACATGATGACCTACTCGAGTAGGTCATCATGTTCAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_030379.1-3821s1c1
Sequence:CCGGGCTCTACTACTACGGCCAGATCTCGAGATCTGGCCGTAGTAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_030379.1-1165s1c1
Sequence:CCGGCCAACGAGAAACCCTACATCTCTCGAGAGATGTAGGGTTTCTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030379.1-1705s1c1
Sequence:CCGGCACTCAAGGATTCCTGCTCATCTCGAGATGAGCAGGAATCCTTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030379
VALIDATED
GLI2 MISSION shRNA shRNA Plasmid DNA
GLI family zinc finger 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_030379.1-4376s1c1
Sequence:CCGGCCGCTTCAGATGACAGATGTTCTCGAGAACATCTGTCATCTGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_030379.1-4229s1c1
Sequence:CCGGGTTCCTGAACATGATGACCTACTCGAGTAGGTCATCATGTTCAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_030379.1-3821s1c1
Sequence:CCGGGCTCTACTACTACGGCCAGATCTCGAGATCTGGCCGTAGTAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_030379.1-1165s1c1
Sequence:CCGGCCAACGAGAAACCCTACATCTCTCGAGAGATGTAGGGTTTCTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030379.1-1705s1c1
Sequence:CCGGCACTCAAGGATTCCTGCTCATCTCGAGATGAGCAGGAATCCTTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030379
VALIDATED
GLI2 MISSION shRNA Lentiviral Transduction Particles
GLI family zinc finger 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_030379.1-4376s1c1
Sequence:CCGGCCGCTTCAGATGACAGATGTTCTCGAGAACATCTGTCATCTGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_030379.1-4229s1c1
Sequence:CCGGGTTCCTGAACATGATGACCTACTCGAGTAGGTCATCATGTTCAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_030379.1-3821s1c1
Sequence:CCGGGCTCTACTACTACGGCCAGATCTCGAGATCTGGCCGTAGTAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_030379.1-1165s1c1
Sequence:CCGGCCAACGAGAAACCCTACATCTCTCGAGAGATGTAGGGTTTCTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030379.1-1705s1c1
Sequence:CCGGCACTCAAGGATTCCTGCTCATCTCGAGATGAGCAGGAATCCTTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks