EMAIL THIS PAGE TO A FRIEND

GLI3

GLI family zinc finger 3

217 Gene Product Result for
Synonyms: ACLS GCPS GLI3-190 GLI3FL PAP-A PAPA PAPA1 PAPB PHS PPDIV
Gene ID:
Human(2737) Summary: This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
Mouse(14634) GLI-Kruppel family member GLI3
Rat(140588) GLI family zinc finger 3
Zebrafish(403042) GLI-Kruppel family member GLI3
chicken(420769) GLI family zinc finger 3
dog(483244) GLI family zinc finger 3
Horse(100064098) GLI family zinc finger 3
domestic cat(101089998) GLI family zinc finger 3
sheep(101119637) GLI family zinc finger 3
Domestic Rabbit(100355047) GLI family zinc finger 3
domestic guinea pig(100719509) GLI family zinc finger 3
naked mole-rat(101703904) GLI family zinc finger 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000168 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000168 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000168 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008130 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008130 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008130 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000168 Rosetta Predictions human pricing
XM_001054276 Rosetta Predictions rat pricing
XM_225411 Rosetta Predictions rat pricing
NM_008130 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115799 predicted 1740
2 SASI_Hs01_00115800 predicted 4881
3 SASI_Hs01_00115801 predicted 556
4 SASI_Hs01_00115802 predicted 567
5 SASI_Hs01_00115803 predicted 321
6 SASI_Hs02_00301999 predicted 1895
7 SASI_Hs01_00115804 predicted 1153
8 SASI_Hs01_00115805 predicted 2463
9 SASI_Hs01_00115806 predicted 619
10 SASI_Hs01_00115807 predicted 3912
11 SASI_Hs01_00115808 predicted 3876
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054276 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275339 predicted 1162
2 SASI_Rn02_00275340 predicted 1367
3 SASI_Rn02_00275341 predicted 253
4 SASI_Rn02_00275342 predicted 4111
5 SASI_Rn02_00275343 predicted 2527
6 SASI_Rn02_00275344 predicted 1802
7 SASI_Rn02_00275345 predicted 2696
8 SASI_Rn02_00275346 predicted 3546
9 SASI_Rn02_00275347 predicted 3295
10 SASI_Rn02_00275348 predicted 1936
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382826 predicted 1166
2 SASI_Rn02_00382827 predicted 1361
3 SASI_Rn02_00382828 predicted 1218
4 SASI_Rn02_00382829 predicted 4120
5 SASI_Rn02_00382830 predicted 2527
6 SASI_Rn02_00382831 predicted 1801
7 SASI_Rn02_00382832 predicted 3958
8 SASI_Rn02_00382833 predicted 2702
9 SASI_Rn02_00382834 predicted 3546
10 SASI_Rn02_00382835 predicted 3298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198378 predicted 2172
2 SASI_Mm02_00313190 predicted 860
3 SASI_Mm01_00198379 predicted 847
4 SASI_Mm01_00198380 predicted 4187
5 SASI_Mm01_00198381 predicted 831
6 SASI_Mm01_00198383 predicted 1381
7 SASI_Mm01_00198384 predicted 2018
8 SASI_Mm01_00198385 predicted 1461
9 SASI_Mm01_00198386 predicted 541
10 SASI_Mm01_00198387 predicted 1795
11 SASI_Mm01_00198382 predicted 329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000168
GLI3 MISSION shRNA Bacterial Glycerol Stock
GLI family zinc finger 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000168.2-4825s1c1
Sequence:CCGGCGGAAATCAATAGGAGTTGAACTCGAGTTCAACTCCTATTGATTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000168.2-4362s1c1
Sequence:CCGGGCAGAATTACTCTGGTCAGTTCTCGAGAACTGACCAGAGTAATTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000168.2-847s1c1
Sequence:CCGGGCCATCCACATGGAATATCTTCTCGAGAAGATATTCCATGTGGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000168.2-130s1c1
Sequence:CCGGCGAACAGATGTGAGCGAGAAACTCGAGTTTCTCGCTCACATCTGTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000168.5-1575s21c1
Sequence:CCGGAGCAGCTTGTGCACCATATAACTCGAGTTATATGGTGCACAAGCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000168.5-2407s21c1
Sequence:CCGGCAAATGGATGGAGCACGTAAACTCGAGTTTACGTGCTCCATCCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000168.5-1386s21c1
Sequence:CCGGACAAGAGGTCCAAGATCAAACCTCGAGGTTTGATCTTGGACCTCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000168
GLI3 MISSION shRNA shRNA Plasmid DNA
GLI family zinc finger 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000168.2-4825s1c1
Sequence:CCGGCGGAAATCAATAGGAGTTGAACTCGAGTTCAACTCCTATTGATTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000168.2-4362s1c1
Sequence:CCGGGCAGAATTACTCTGGTCAGTTCTCGAGAACTGACCAGAGTAATTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000168.2-847s1c1
Sequence:CCGGGCCATCCACATGGAATATCTTCTCGAGAAGATATTCCATGTGGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000168.2-130s1c1
Sequence:CCGGCGAACAGATGTGAGCGAGAAACTCGAGTTTCTCGCTCACATCTGTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000168.5-1575s21c1
Sequence:CCGGAGCAGCTTGTGCACCATATAACTCGAGTTATATGGTGCACAAGCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000168.5-2407s21c1
Sequence:CCGGCAAATGGATGGAGCACGTAAACTCGAGTTTACGTGCTCCATCCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000168.5-1386s21c1
Sequence:CCGGACAAGAGGTCCAAGATCAAACCTCGAGGTTTGATCTTGGACCTCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000168
GLI3 MISSION shRNA Lentiviral Transduction Particles
GLI family zinc finger 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000168.2-4825s1c1
Sequence:CCGGCGGAAATCAATAGGAGTTGAACTCGAGTTCAACTCCTATTGATTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000168.2-4362s1c1
Sequence:CCGGGCAGAATTACTCTGGTCAGTTCTCGAGAACTGACCAGAGTAATTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000168.2-847s1c1
Sequence:CCGGGCCATCCACATGGAATATCTTCTCGAGAAGATATTCCATGTGGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000168.2-130s1c1
Sequence:CCGGCGAACAGATGTGAGCGAGAAACTCGAGTTTCTCGCTCACATCTGTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000168.5-1575s21c1
Sequence:CCGGAGCAGCTTGTGCACCATATAACTCGAGTTATATGGTGCACAAGCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000168.5-2407s21c1
Sequence:CCGGCAAATGGATGGAGCACGTAAACTCGAGTTTACGTGCTCCATCCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000168.5-1386s21c1
Sequence:CCGGACAAGAGGTCCAAGATCAAACCTCGAGGTTTGATCTTGGACCTCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008130
GLI3 MISSION shRNA Bacterial Glycerol Stock
GLI family zinc finger 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008130.1-4485s1c1
Sequence:CCGGGCAGAATTATTCCGGTCAGTTCTCGAGAACTGACCGGAATAATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008130.1-1118s1c1
Sequence:CCGGCCTTGGTTACAATCCTCAATACTCGAGTATTGAGGATTGTAACCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008130.1-3772s1c1
Sequence:CCGGCCACATAATCTGTGGAAGGTTCTCGAGAACCTTCCACAGATTATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008130.1-3418s1c1
Sequence:CCGGGATGCTAACTTGAATGATGAACTCGAGTTCATCATTCAAGTTAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008130.1-1976s1c1
Sequence:CCGGCCAATGAGAAACCGTATGTATCTCGAGATACATACGGTTTCTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008130
GLI3 MISSION shRNA shRNA Plasmid DNA
GLI family zinc finger 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008130.1-4485s1c1
Sequence:CCGGGCAGAATTATTCCGGTCAGTTCTCGAGAACTGACCGGAATAATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008130.1-1118s1c1
Sequence:CCGGCCTTGGTTACAATCCTCAATACTCGAGTATTGAGGATTGTAACCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008130.1-3772s1c1
Sequence:CCGGCCACATAATCTGTGGAAGGTTCTCGAGAACCTTCCACAGATTATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008130.1-3418s1c1
Sequence:CCGGGATGCTAACTTGAATGATGAACTCGAGTTCATCATTCAAGTTAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008130.1-1976s1c1
Sequence:CCGGCCAATGAGAAACCGTATGTATCTCGAGATACATACGGTTTCTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008130
GLI3 MISSION shRNA Lentiviral Transduction Particles
GLI family zinc finger 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008130.1-4485s1c1
Sequence:CCGGGCAGAATTATTCCGGTCAGTTCTCGAGAACTGACCGGAATAATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008130.1-1118s1c1
Sequence:CCGGCCTTGGTTACAATCCTCAATACTCGAGTATTGAGGATTGTAACCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008130.1-3772s1c1
Sequence:CCGGCCACATAATCTGTGGAAGGTTCTCGAGAACCTTCCACAGATTATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008130.1-3418s1c1
Sequence:CCGGGATGCTAACTTGAATGATGAACTCGAGTTCATCATTCAAGTTAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008130.1-1976s1c1
Sequence:CCGGCCAATGAGAAACCGTATGTATCTCGAGATACATACGGTTTCTCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)