EMAIL THIS PAGE TO A FRIEND

GLI4

GLI family zinc finger 4

29 Gene Product Result for
Synonyms: HKR4 ZNF928
UniProtKB ID: P10075, Q96CK9
Gene ID:
Rat(500893) GLI family zinc finger 4
domestic guinea pig(101788329) GLI family zinc finger 4
naked mole-rat(101726685) GLI family zinc finger 4
sheep(101115287) GLI family zinc finger 4
dog(100684283) GLI family zinc finger 4
cow(518201) GLI family zinc finger 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138465 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138465 Rosetta Predictions human pricing
NM_001029926 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163206 predicted 224
2 SASI_Hs01_00163207 predicted 281
3 SASI_Hs01_00163208 predicted 644
4 SASI_Hs01_00163209 predicted 270
5 SASI_Hs01_00163210 predicted 654
6 SASI_Hs01_00163211 predicted 295
7 SASI_Hs01_00163213 predicted 1302
8 SASI_Hs01_00163214 predicted 1302
9 SASI_Hs01_00163212 predicted 180
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029926 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106307 predicted 1738
2 SASI_Rn01_00106308 predicted 1498
3 SASI_Rn02_00203501 predicted 1409
4 SASI_Rn01_00106309 predicted 991
5 SASI_Rn01_00106310 predicted 1209
6 SASI_Rn01_00106311 predicted 1306
7 SASI_Rn01_00106312 predicted 1127
8 SASI_Rn01_00106313 predicted 913
9 SASI_Rn01_00106314 predicted 1851
10 SASI_Rn02_00203502 predicted 1809
11 SASI_Rn01_00106315 predicted 1339
12 SASI_Rn01_00106316 predicted 989
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138465
GLI4 MISSION shRNA Bacterial Glycerol Stock
GLI family zinc finger 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138465.3-571s21c1
Sequence:CCGGTGCCGAGCTGGGAGTCAACTTCTCGAGAAGTTGACTCCCAGCTCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138465.3-265s21c1
Sequence:CCGGAGACGTAGAGGAAGTGGAGATCTCGAGATCTCCACTTCCTCTACGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138465.3-281s21c1
Sequence:CCGGGAGATCGGCAGAGACACCTTCCTCGAGGAAGGTGTCTCTGCCGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138465.3-649s1c1
Sequence:CCGGCGGCAAGAGTTTCAAGTATAACTCGAGTTATACTTGAAACTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138465.3-245s1c1
Sequence:CCGGCCGTCCGACCTGGATCTCCAACTCGAGTTGGAGATCCAGGTCGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138465.3-257s1c1
Sequence:CCGGGATCTCCAAGACGTAGAGGAACTCGAGTTCCTCTACGTCTTGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138465.3-651s1c1
Sequence:CCGGGCAAGAGTTTCAAGTATAACTCTCGAGAGTTATACTTGAAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138465.3-1195s1c1
Sequence:CCGGGCGGGTGCACTACCGCGAGTACTCGAGTACTCGCGGTAGTGCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138465
GLI4 MISSION shRNA shRNA Plasmid DNA
GLI family zinc finger 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138465.3-571s21c1
Sequence:CCGGTGCCGAGCTGGGAGTCAACTTCTCGAGAAGTTGACTCCCAGCTCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138465.3-265s21c1
Sequence:CCGGAGACGTAGAGGAAGTGGAGATCTCGAGATCTCCACTTCCTCTACGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138465.3-281s21c1
Sequence:CCGGGAGATCGGCAGAGACACCTTCCTCGAGGAAGGTGTCTCTGCCGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138465.3-649s1c1
Sequence:CCGGCGGCAAGAGTTTCAAGTATAACTCGAGTTATACTTGAAACTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138465.3-245s1c1
Sequence:CCGGCCGTCCGACCTGGATCTCCAACTCGAGTTGGAGATCCAGGTCGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138465.3-257s1c1
Sequence:CCGGGATCTCCAAGACGTAGAGGAACTCGAGTTCCTCTACGTCTTGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138465.3-651s1c1
Sequence:CCGGGCAAGAGTTTCAAGTATAACTCTCGAGAGTTATACTTGAAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138465.3-1195s1c1
Sequence:CCGGGCGGGTGCACTACCGCGAGTACTCGAGTACTCGCGGTAGTGCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138465
GLI4 MISSION shRNA Lentiviral Transduction Particles
GLI family zinc finger 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138465.3-571s21c1
Sequence:CCGGTGCCGAGCTGGGAGTCAACTTCTCGAGAAGTTGACTCCCAGCTCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138465.3-265s21c1
Sequence:CCGGAGACGTAGAGGAAGTGGAGATCTCGAGATCTCCACTTCCTCTACGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138465.3-281s21c1
Sequence:CCGGGAGATCGGCAGAGACACCTTCCTCGAGGAAGGTGTCTCTGCCGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138465.3-649s1c1
Sequence:CCGGCGGCAAGAGTTTCAAGTATAACTCGAGTTATACTTGAAACTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138465.3-245s1c1
Sequence:CCGGCCGTCCGACCTGGATCTCCAACTCGAGTTGGAGATCCAGGTCGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138465.3-257s1c1
Sequence:CCGGGATCTCCAAGACGTAGAGGAACTCGAGTTCCTCTACGTCTTGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138465.3-651s1c1
Sequence:CCGGGCAAGAGTTTCAAGTATAACTCTCGAGAGTTATACTTGAAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138465.3-1195s1c1
Sequence:CCGGGCGGGTGCACTACCGCGAGTACTCGAGTACTCGCGGTAGTGCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks