EMAIL THIS PAGE TO A FRIEND

GLIPR1

GLI pathogenesis-related 1

90 Gene Product Result for
Synonyms: CRISP7 GLIPR RTVP1
UniProtKB ID: P48060, A7YET6, F8VUC2, Q15409, Q969K2
Gene ID:
Human(11010) Summary: This gene encodes a protein with similarity to both the pathogenesis-related protein (PR) superfamily and the cysteine-rich secretory protein (CRISP) family. Increased expression of this gene is associated with myelomocytic differentiation in macrophage and decreased expression of this gene through gene methylation is associated with prostate cancer. The protein has proapoptotic activities in prostate and bladder cancer cells. This gene is a member of a cluster on chromosome 12 containing two other similar genes. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
Mouse(73690) GLI pathogenesis-related 1 (glioma)
Rat(299783) GLI pathogenesis-related 1
chicken(427869) GLI pathogenesis-related 1 (glioma)
dog(474452) GLI pathogenesis-related 1
domestic cat(101087587) GLI pathogenesis-related 1
cow(767905) GLI pathogenesis-related 1
sheep(101121758) GLI pathogenesis-related 1
domestic guinea pig(100727426) GLI pathogenesis-related 1
naked mole-rat(101710415) GLI pathogenesis-related 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006851 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006851 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006851 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028608 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028608 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028608 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006851 Rosetta Predictions human pricing
NM_001011987 Rosetta Predictions rat pricing
XM_576223 Rosetta Predictions rat pricing
NM_028608 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027776 predicted 330
2 SASI_Hs02_00342451 predicted 631
3 SASI_Hs02_00342452 predicted 622
4 SASI_Hs01_00027778 predicted 615
5 SASI_Hs01_00027780 predicted 517
6 SASI_Hs02_00342453 predicted 1241
7 SASI_Hs02_00342454 predicted 1292
8 SASI_Hs02_00342455 predicted 1291
9 SASI_Hs01_00027783 predicted 664
10 SASI_Hs02_00342456 predicted 274
11 SASI_Hs01_00027777 predicted 554
12 SASI_Hs01_00027779 predicted 674
13 SASI_Hs01_00027781 predicted 741
14 SASI_Hs01_00027782 predicted 468
15 SASI_Hs01_00027784 predicted 541
16 SASI_Hs01_00027785 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104155 predicted 640
2 SASI_Rn01_00104156 predicted 576
3 SASI_Rn01_00104157 predicted 260
4 SASI_Rn01_00104158 predicted 321
5 SASI_Rn01_00104159 predicted 242
6 SASI_Rn01_00104160 predicted 292
7 SASI_Rn01_00104161 predicted 439
8 SASI_Rn01_00104162 predicted 406
9 SASI_Rn01_00104163 predicted 295
10 SASI_Rn01_00104164 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00185613 predicted 645
2 SASI_Rn01_00185614 predicted 577
3 SASI_Rn01_00185615 predicted 265
4 SASI_Rn01_00185616 predicted 329
5 SASI_Rn01_00185617 predicted 242
6 SASI_Rn01_00185618 predicted 297
7 SASI_Rn01_00185619 predicted 450
8 SASI_Rn01_00185620 predicted 408
9 SASI_Rn01_00185621 predicted 303
10 SASI_Rn01_00185622 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028608 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185394 predicted 578
2 SASI_Mm01_00185395 predicted 554
3 SASI_Mm01_00185396 predicted 726
4 SASI_Mm01_00185397 predicted 328
5 SASI_Mm01_00185398 predicted 776
6 SASI_Mm01_00185399 predicted 315
7 SASI_Mm01_00185400 predicted 446
8 SASI_Mm01_00185401 predicted 771
9 SASI_Mm01_00185402 predicted 444
10 SASI_Mm01_00185403 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006851
VALIDATED
GLIPR1 MISSION shRNA Bacterial Glycerol Stock
GLI pathogenesis-related 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006851.1-619s1c1
Sequence:CCGGCTCTTTCCAATGGAGCACATTCTCGAGAATGTGCTCCATTGGAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006851.1-479s1c1
Sequence:CCGGGTATGACGAAATCCAGGACTACTCGAGTAGTCCTGGATTTCGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006851.1-283s1c1
Sequence:CCGGCCAGTGATATGCTATACATGACTCGAGTCATGTATAGCATATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006851.1-239s1c1
Sequence:CCGGCGTTCGAATCCATAACAAGTTCTCGAGAACTTGTTATGGATTCGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006851.2-259s21c1
Sequence:CCGGCGTTCGAATCCATAACAAGTTCTCGAGAACTTGTTATGGATTCGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006851.2-639s21c1
Sequence:CCGGCTCTTTCCAATGGAGCACATTCTCGAGAATGTGCTCCATTGGAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006851.2-499s21c1
Sequence:CCGGGTATGACGAAATCCAGGACTACTCGAGTAGTCCTGGATTTCGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006851.2-303s21c1
Sequence:CCGGCCAGTGATATGCTATACATGACTCGAGTCATGTATAGCATATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006851
VALIDATED
GLIPR1 MISSION shRNA shRNA Plasmid DNA
GLI pathogenesis-related 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006851.1-619s1c1
Sequence:CCGGCTCTTTCCAATGGAGCACATTCTCGAGAATGTGCTCCATTGGAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006851.1-479s1c1
Sequence:CCGGGTATGACGAAATCCAGGACTACTCGAGTAGTCCTGGATTTCGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006851.1-283s1c1
Sequence:CCGGCCAGTGATATGCTATACATGACTCGAGTCATGTATAGCATATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006851.1-239s1c1
Sequence:CCGGCGTTCGAATCCATAACAAGTTCTCGAGAACTTGTTATGGATTCGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006851.2-259s21c1
Sequence:CCGGCGTTCGAATCCATAACAAGTTCTCGAGAACTTGTTATGGATTCGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006851.2-639s21c1
Sequence:CCGGCTCTTTCCAATGGAGCACATTCTCGAGAATGTGCTCCATTGGAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006851.2-499s21c1
Sequence:CCGGGTATGACGAAATCCAGGACTACTCGAGTAGTCCTGGATTTCGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006851.2-303s21c1
Sequence:CCGGCCAGTGATATGCTATACATGACTCGAGTCATGTATAGCATATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006851
VALIDATED
GLIPR1 MISSION shRNA Lentiviral Transduction Particles
GLI pathogenesis-related 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006851.1-619s1c1
Sequence:CCGGCTCTTTCCAATGGAGCACATTCTCGAGAATGTGCTCCATTGGAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006851.1-479s1c1
Sequence:CCGGGTATGACGAAATCCAGGACTACTCGAGTAGTCCTGGATTTCGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006851.1-283s1c1
Sequence:CCGGCCAGTGATATGCTATACATGACTCGAGTCATGTATAGCATATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006851.1-239s1c1
Sequence:CCGGCGTTCGAATCCATAACAAGTTCTCGAGAACTTGTTATGGATTCGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006851.2-259s21c1
Sequence:CCGGCGTTCGAATCCATAACAAGTTCTCGAGAACTTGTTATGGATTCGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006851.2-639s21c1
Sequence:CCGGCTCTTTCCAATGGAGCACATTCTCGAGAATGTGCTCCATTGGAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006851.2-499s21c1
Sequence:CCGGGTATGACGAAATCCAGGACTACTCGAGTAGTCCTGGATTTCGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006851.2-303s21c1
Sequence:CCGGCCAGTGATATGCTATACATGACTCGAGTCATGTATAGCATATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028608
VALIDATED
GLIPR1 MISSION shRNA Bacterial Glycerol Stock
GLI pathogenesis-related 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028608.1-613s1c1
Sequence:CCGGGCAGTGCAACTTTGCCCTAATCTCGAGATTAGGGCAAAGTTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028608.1-622s1c1
Sequence:CCGGCTTTGCCCTAATGGAGCAAATCTCGAGATTTGCTCCATTAGGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028608.1-230s1c1
Sequence:CCGGCAAGCACTTTGCCAGATATAACTCGAGTTATATCTGGCAAAGTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028608.1-415s1c1
Sequence:CCGGCATTCACGGATACACCCAAATCTCGAGATTTGGGTGTATCCGTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028608.1-229s1c1
Sequence:CCGGGCAAGCACTTTGCCAGATATACTCGAGTATATCTGGCAAAGTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028608.3-483s21c1
Sequence:CCGGCATTCACGGATACACCCAAATCTCGAGATTTGGGTGTATCCGTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028608.3-681s21c1
Sequence:CCGGGCAGTGCAACTTTGCCCTAATCTCGAGATTAGGGCAAAGTTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028608.3-652s21c1
Sequence:CCGGTTTGGGCAGACAGTTACAAACCTCGAGGTTTGTAACTGTCTGCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028608.3-524s21c1
Sequence:CCGGTATCTGGCTTGGCTCTCTATCCTCGAGGATAGAGAGCCAAGCCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028608.3-623s21c1
Sequence:CCGGACATGTCTGTGGCCATTATACCTCGAGGTATAATGGCCACAGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028608
VALIDATED
GLIPR1 MISSION shRNA shRNA Plasmid DNA
GLI pathogenesis-related 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028608.1-613s1c1
Sequence:CCGGGCAGTGCAACTTTGCCCTAATCTCGAGATTAGGGCAAAGTTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028608.1-622s1c1
Sequence:CCGGCTTTGCCCTAATGGAGCAAATCTCGAGATTTGCTCCATTAGGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028608.1-230s1c1
Sequence:CCGGCAAGCACTTTGCCAGATATAACTCGAGTTATATCTGGCAAAGTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028608.1-415s1c1
Sequence:CCGGCATTCACGGATACACCCAAATCTCGAGATTTGGGTGTATCCGTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028608.1-229s1c1
Sequence:CCGGGCAAGCACTTTGCCAGATATACTCGAGTATATCTGGCAAAGTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028608.3-483s21c1
Sequence:CCGGCATTCACGGATACACCCAAATCTCGAGATTTGGGTGTATCCGTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028608.3-681s21c1
Sequence:CCGGGCAGTGCAACTTTGCCCTAATCTCGAGATTAGGGCAAAGTTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028608.3-652s21c1
Sequence:CCGGTTTGGGCAGACAGTTACAAACCTCGAGGTTTGTAACTGTCTGCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028608.3-524s21c1
Sequence:CCGGTATCTGGCTTGGCTCTCTATCCTCGAGGATAGAGAGCCAAGCCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028608.3-623s21c1
Sequence:CCGGACATGTCTGTGGCCATTATACCTCGAGGTATAATGGCCACAGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028608
VALIDATED
GLIPR1 MISSION shRNA Lentiviral Transduction Particles
GLI pathogenesis-related 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028608.1-613s1c1
Sequence:CCGGGCAGTGCAACTTTGCCCTAATCTCGAGATTAGGGCAAAGTTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028608.1-622s1c1
Sequence:CCGGCTTTGCCCTAATGGAGCAAATCTCGAGATTTGCTCCATTAGGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028608.1-230s1c1
Sequence:CCGGCAAGCACTTTGCCAGATATAACTCGAGTTATATCTGGCAAAGTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028608.1-415s1c1
Sequence:CCGGCATTCACGGATACACCCAAATCTCGAGATTTGGGTGTATCCGTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028608.1-229s1c1
Sequence:CCGGGCAAGCACTTTGCCAGATATACTCGAGTATATCTGGCAAAGTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028608.3-483s21c1
Sequence:CCGGCATTCACGGATACACCCAAATCTCGAGATTTGGGTGTATCCGTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028608.3-681s21c1
Sequence:CCGGGCAGTGCAACTTTGCCCTAATCTCGAGATTAGGGCAAAGTTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028608.3-652s21c1
Sequence:CCGGTTTGGGCAGACAGTTACAAACCTCGAGGTTTGTAACTGTCTGCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028608.3-524s21c1
Sequence:CCGGTATCTGGCTTGGCTCTCTATCCTCGAGGATAGAGAGCCAAGCCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028608.3-623s21c1
Sequence:CCGGACATGTCTGTGGCCATTATACCTCGAGGTATAATGGCCACAGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks