EMAIL THIS PAGE TO A FRIEND

GLIPR1L1

GLI pathogenesis-related 1 like 1

83 Gene Product Result for
Synonyms: ALKN2972 PRO7434
UniProtKB ID: Q6UWM5, Q96L06
Gene ID:
Mouse(69286) GLI pathogenesis-related 1 like 1
Rat(503139) GLI pathogenesis-related 1 like 1
domestic cat(101087075) GLI pathogenesis-related 1 like 1
cow(615034) GLI pathogenesis-related 1 like 1
dog(610032) GLI pathogenesis-related 1 like 1
domestic guinea pig(100716669) GLI pathogenesis-related 1 like 1
sheep(101121503) GLI pathogenesis-related 1 like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027018 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027018 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027018 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152779 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152779 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152779 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152779 Rosetta Predictions human pricing
XM_578660 Rosetta Predictions rat pricing
XR_009412 Rosetta Predictions rat pricing
XM_916000 Rosetta Predictions mouse pricing
XM_993553 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012574 predicted 464
2 SASI_Hs01_00012575 predicted 217
3 SASI_Hs01_00012576 predicted 422
4 SASI_Hs01_00012577 predicted 258
5 SASI_Hs02_00366720 predicted 362
6 SASI_Hs01_00012578 predicted 381
7 SASI_Hs01_00012580 predicted 390
8 SASI_Hs01_00012581 predicted 214
9 SASI_Hs01_00012582 predicted 376
10 SASI_Hs01_00012583 predicted 268
11 SASI_Hs01_00012579 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00155531 predicted 249
2 SASI_Rn01_00155532 predicted 249
3 SASI_Rn01_00155533 predicted 243
4 SASI_Rn01_00155534 predicted 271
5 SASI_Rn01_00155535 predicted 260
6 SASI_Rn01_00155536 predicted 245
7 SASI_Rn01_00155537 predicted 251
8 SASI_Rn01_00155538 predicted 265
9 SASI_Rn01_00155539 predicted 250
10 SASI_Rn01_00155540 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009412 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00419634 predicted 291
2 SASI_Rn01_00171074 predicted 335
3 SASI_Rn01_00171076 predicted 359
4 SASI_Rn02_00419635 predicted 294
5 SASI_Rn02_00419636 predicted 297
6 SASI_Rn02_00419637 predicted 285
7 SASI_Rn01_00171079 predicted 401
8 SASI_Rn01_00171080 predicted 406
9 SASI_Rn02_00419638 predicted 411
10 SASI_Rn02_00419639 predicted 342
11 SASI_Rn01_00171072 predicted 345
12 SASI_Rn01_00171073 predicted 348
13 SASI_Rn01_00171075 predicted 369
14 SASI_Rn01_00171077 predicted 352
15 SASI_Rn01_00171078 predicted 343
16 SASI_Rn01_00171081 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439942 predicted 232
2 SASI_Mm02_00439943 predicted 373
3 SASI_Mm02_00439944 predicted 312
4 SASI_Mm02_00439945 predicted 241
5 SASI_Mm02_00439946 predicted 246
6 SASI_Mm02_00439947 predicted 355
7 SASI_Mm02_00439948 predicted 359
8 SASI_Mm02_00439949 predicted 244
9 SASI_Mm02_00439950 predicted 238
10 SASI_Mm02_00439951 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_993553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00451360 predicted 402
2 SASI_Mm01_00285817 predicted 221
3 SASI_Mm01_00285819 predicted 531
4 SASI_Mm01_00285820 predicted 215
5 SASI_Mm01_00285823 predicted 398
6 SASI_Mm01_00285824 predicted 546
7 SASI_Mm02_00451361 predicted 400
8 SASI_Mm02_00451362 predicted 659
9 SASI_Mm02_00451363 predicted 531
10 SASI_Mm02_00451364 predicted 442
11 SASI_Mm01_00285816 predicted 366
12 SASI_Mm01_00285818 predicted 347
13 SASI_Mm01_00285821 predicted 372
14 SASI_Mm01_00285822 predicted 305
15 SASI_Mm01_00285825 predicted 634
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027018
GLIPR1L1 MISSION shRNA Bacterial Glycerol Stock
GLI pathogenesis-related 1 like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027018.1-656s21c1
Sequence:CCGGTCGCCAGCAGGAAACTTTATACTCGAGTATAAAGTTTCCTGCTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027018.1-378s21c1
Sequence:CCGGCCCATAATCCCTGTATCAAACCTCGAGGTTTGATACAGGGATTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027018.1-405s21c1
Sequence:CCGGACGAATGTCTTGAGGACTATGCTCGAGCATAGTCCTCAAGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027018.1-538s21c1
Sequence:CCGGTGAAATGTGTGGCCATTATACCTCGAGGTATAATGGCCACACATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027018.1-224s21c1
Sequence:CCGGACTATCACGGATCCGAAATTTCTCGAGAAATTTCGGATCCGTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027018
GLIPR1L1 MISSION shRNA shRNA Plasmid DNA
GLI pathogenesis-related 1 like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027018.1-656s21c1
Sequence:CCGGTCGCCAGCAGGAAACTTTATACTCGAGTATAAAGTTTCCTGCTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027018.1-378s21c1
Sequence:CCGGCCCATAATCCCTGTATCAAACCTCGAGGTTTGATACAGGGATTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027018.1-405s21c1
Sequence:CCGGACGAATGTCTTGAGGACTATGCTCGAGCATAGTCCTCAAGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027018.1-538s21c1
Sequence:CCGGTGAAATGTGTGGCCATTATACCTCGAGGTATAATGGCCACACATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027018.1-224s21c1
Sequence:CCGGACTATCACGGATCCGAAATTTCTCGAGAAATTTCGGATCCGTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027018
GLIPR1L1 MISSION shRNA Lentiviral Transduction Particles
GLI pathogenesis-related 1 like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027018.1-656s21c1
Sequence:CCGGTCGCCAGCAGGAAACTTTATACTCGAGTATAAAGTTTCCTGCTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027018.1-378s21c1
Sequence:CCGGCCCATAATCCCTGTATCAAACCTCGAGGTTTGATACAGGGATTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027018.1-405s21c1
Sequence:CCGGACGAATGTCTTGAGGACTATGCTCGAGCATAGTCCTCAAGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027018.1-538s21c1
Sequence:CCGGTGAAATGTGTGGCCATTATACCTCGAGGTATAATGGCCACACATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027018.1-224s21c1
Sequence:CCGGACTATCACGGATCCGAAATTTCTCGAGAAATTTCGGATCCGTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152779
GLIPR1L1 MISSION shRNA Bacterial Glycerol Stock
GLI pathogenesis-related 1 like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152779.2-204s21c1
Sequence:CCGGCCGACATGAAATACATGATTTCTCGAGAAATCATGTATTTCATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152779.2-343s21c1
Sequence:CCGGTATCTGGTTAGGTGGAATAAACTCGAGTTTATTCCACCTAACCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152779.2-442s21c1
Sequence:CCGGCAGAGTCTGTGGCCATTATACCTCGAGGTATAATGGCCACAGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152779.2-257s21c1
Sequence:CCGGTGGGCAAACCAGTGCAAATTTCTCGAGAAATTTGCACTGGTTTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152779.1-592s1c1
Sequence:CCGGCCTCCTTACGTAAGAGGAGAACTCGAGTTCTCCTCTTACGTAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152779.1-458s1c1
Sequence:CCGGGCCATTATACACAGTTAGTTTCTCGAGAAACTAACTGTGTATAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152779.1-398s1c1
Sequence:CCGGCTTGGTATAATGAAACCCAATCTCGAGATTGGGTTTCATTATACCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152779.1-145s1c1
Sequence:CCGGCACTTTATAGACAACTGCATACTCGAGTATGCAGTTGTCTATAAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152779.1-820s1c1
Sequence:CCGGCTTATCATCACTTTGCTTCTTCTCGAGAAGAAGCAAAGTGATGATAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152779
GLIPR1L1 MISSION shRNA shRNA Plasmid DNA
GLI pathogenesis-related 1 like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152779.2-204s21c1
Sequence:CCGGCCGACATGAAATACATGATTTCTCGAGAAATCATGTATTTCATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152779.2-343s21c1
Sequence:CCGGTATCTGGTTAGGTGGAATAAACTCGAGTTTATTCCACCTAACCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152779.2-442s21c1
Sequence:CCGGCAGAGTCTGTGGCCATTATACCTCGAGGTATAATGGCCACAGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152779.2-257s21c1
Sequence:CCGGTGGGCAAACCAGTGCAAATTTCTCGAGAAATTTGCACTGGTTTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152779.1-592s1c1
Sequence:CCGGCCTCCTTACGTAAGAGGAGAACTCGAGTTCTCCTCTTACGTAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152779.1-458s1c1
Sequence:CCGGGCCATTATACACAGTTAGTTTCTCGAGAAACTAACTGTGTATAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152779.1-398s1c1
Sequence:CCGGCTTGGTATAATGAAACCCAATCTCGAGATTGGGTTTCATTATACCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152779.1-145s1c1
Sequence:CCGGCACTTTATAGACAACTGCATACTCGAGTATGCAGTTGTCTATAAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152779.1-820s1c1
Sequence:CCGGCTTATCATCACTTTGCTTCTTCTCGAGAAGAAGCAAAGTGATGATAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152779
GLIPR1L1 MISSION shRNA Lentiviral Transduction Particles
GLI pathogenesis-related 1 like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152779.2-204s21c1
Sequence:CCGGCCGACATGAAATACATGATTTCTCGAGAAATCATGTATTTCATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152779.2-343s21c1
Sequence:CCGGTATCTGGTTAGGTGGAATAAACTCGAGTTTATTCCACCTAACCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152779.2-442s21c1
Sequence:CCGGCAGAGTCTGTGGCCATTATACCTCGAGGTATAATGGCCACAGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152779.2-257s21c1
Sequence:CCGGTGGGCAAACCAGTGCAAATTTCTCGAGAAATTTGCACTGGTTTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152779.1-592s1c1
Sequence:CCGGCCTCCTTACGTAAGAGGAGAACTCGAGTTCTCCTCTTACGTAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152779.1-458s1c1
Sequence:CCGGGCCATTATACACAGTTAGTTTCTCGAGAAACTAACTGTGTATAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152779.1-398s1c1
Sequence:CCGGCTTGGTATAATGAAACCCAATCTCGAGATTGGGTTTCATTATACCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152779.1-145s1c1
Sequence:CCGGCACTTTATAGACAACTGCATACTCGAGTATGCAGTTGTCTATAAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152779.1-820s1c1
Sequence:CCGGCTTATCATCACTTTGCTTCTTCTCGAGAAGAAGCAAAGTGATGATAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks