EMAIL THIS PAGE TO A FRIEND

GLIPR1L2

GLI pathogenesis-related 1 like 2

85 Gene Product Result for
UniProtKB ID: Q4G1C9, Q6MZS1, Q8N6N0, Q8NA43
Gene ID:
Human(144321) Summary: This gene encodes a member of the cysteine-rich secretory protein, antigen 5, and pathogenesis-related 1 superfamily. Members of this family have roles in a variety of processes, including cancer and immune defense. This gene is located in a cluster with two related genes on chromosome 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Mouse(67537) GLI pathogenesis-related 1 like 2
Rat(366890) GLI pathogenesis-related 1 like 2
sheep(101123622) GLI pathogenesis-related 1 like 2
domestic guinea pig(100716106) GLI pathogenesis-related 1 like 2
naked mole-rat(101720168) GLI pathogenesis-related 1 like 2
chicken(417861) GLI pathogenesis-related 1 like 2
dog(481170) GLI pathogenesis-related 1 like 2
cow(536555) GLI pathogenesis-related 1 like 2
domestic cat(101087329) GLI pathogenesis-related 1 like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152436 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026223 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026223 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026223 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152436 Rosetta Predictions human pricing
XM_345821 Rosetta Predictions rat pricing
XR_009411 Rosetta Predictions rat pricing
NM_026223 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012724 predicted 817
2 SASI_Hs01_00012725 predicted 790
3 SASI_Hs01_00012726 predicted 246
4 SASI_Hs01_00012727 predicted 860
5 SASI_Hs01_00012728 predicted 252
6 SASI_Hs01_00012729 predicted 604
7 SASI_Hs01_00012730 predicted 466
8 SASI_Hs01_00012731 predicted 217
9 SASI_Hs01_00012732 predicted 314
10 SASI_Hs01_00012733 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345821 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00170878 predicted 1382
2 SASI_Rn01_00170879 predicted 1399
3 SASI_Rn01_00170880 predicted 1339
4 SASI_Rn01_00170881 predicted 1308
5 SASI_Rn01_00170882 predicted 1264
6 SASI_Rn01_00170883 predicted 1141
7 SASI_Rn01_00170884 predicted 1411
8 SASI_Rn01_00170885 predicted 1401
9 SASI_Rn01_00170886 predicted 938
10 SASI_Rn01_00170887 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00149215 predicted 230
2 SASI_Rn01_00149216 predicted 421
3 SASI_Rn01_00149217 predicted 290
4 SASI_Rn01_00149218 predicted 372
5 SASI_Rn01_00149219 predicted 410
6 SASI_Rn01_00149220 predicted 213
7 SASI_Rn01_00149221 predicted 284
8 SASI_Rn01_00149222 predicted 311
9 SASI_Rn01_00149223 predicted 241
10 SASI_Rn02_00419633 predicted 219
11 SASI_Rn01_00149224 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189713 predicted 298
2 SASI_Mm02_00329901 predicted 245
3 SASI_Mm01_00189714 predicted 617
4 SASI_Mm01_00189715 predicted 677
5 SASI_Mm01_00189716 predicted 333
6 SASI_Mm01_00189717 predicted 479
7 SASI_Mm01_00189718 predicted 248
8 SASI_Mm01_00189719 predicted 467
9 SASI_Mm01_00189720 predicted 440
10 SASI_Mm01_00189721 predicted 698
11 SASI_Mm01_00189712 predicted 443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152436
GLIPR1L2 MISSION shRNA Bacterial Glycerol Stock
GLI pathogenesis-related 1 like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152436.1-610s1c1
Sequence:CCGGGACCTTATGAACCAGGAATATCTCGAGATATTCCTGGTTCATAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152436.1-158s1c1
Sequence:CCGGCGTAGACTTTATCAACGAGTACTCGAGTACTCGTTGATAAAGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152436.1-1457s1c1
Sequence:CCGGCCATGTGTTCTCATTGTTCAACTCGAGTTGAACAATGAGAACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152436.1-1309s1c1
Sequence:CCGGGCAGGTTTGTTACATAGGTATCTCGAGATACCTATGTAACAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152436.1-324s1c1
Sequence:CCGGGTACAAATGGTCCATCCTAAACTCGAGTTTAGGATGGACCATTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152436.1-930s21c1
Sequence:CCGGACTAACAGTTATACCCTTAAACTCGAGTTTAAGGGTATAACTGTTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152436.1-780s21c1
Sequence:CCGGTTTGATCAGAATGCTACTATTCTCGAGAATAGTAGCATTCTGATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152436.1-385s21c1
Sequence:CCGGATGAATTTACTGCAAGTATTGCTCGAGCAATACTTGCAGTAAATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152436.1-994s21c1
Sequence:CCGGACTGCTTTAAAGGATAGTATACTCGAGTATACTATCCTTTAAAGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152436
GLIPR1L2 MISSION shRNA shRNA Plasmid DNA
GLI pathogenesis-related 1 like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152436.1-610s1c1
Sequence:CCGGGACCTTATGAACCAGGAATATCTCGAGATATTCCTGGTTCATAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152436.1-158s1c1
Sequence:CCGGCGTAGACTTTATCAACGAGTACTCGAGTACTCGTTGATAAAGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152436.1-1457s1c1
Sequence:CCGGCCATGTGTTCTCATTGTTCAACTCGAGTTGAACAATGAGAACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152436.1-1309s1c1
Sequence:CCGGGCAGGTTTGTTACATAGGTATCTCGAGATACCTATGTAACAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152436.1-324s1c1
Sequence:CCGGGTACAAATGGTCCATCCTAAACTCGAGTTTAGGATGGACCATTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152436.1-930s21c1
Sequence:CCGGACTAACAGTTATACCCTTAAACTCGAGTTTAAGGGTATAACTGTTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152436.1-780s21c1
Sequence:CCGGTTTGATCAGAATGCTACTATTCTCGAGAATAGTAGCATTCTGATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152436.1-385s21c1
Sequence:CCGGATGAATTTACTGCAAGTATTGCTCGAGCAATACTTGCAGTAAATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152436.1-994s21c1
Sequence:CCGGACTGCTTTAAAGGATAGTATACTCGAGTATACTATCCTTTAAAGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152436
GLIPR1L2 MISSION shRNA Lentiviral Transduction Particles
GLI pathogenesis-related 1 like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152436.1-610s1c1
Sequence:CCGGGACCTTATGAACCAGGAATATCTCGAGATATTCCTGGTTCATAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152436.1-158s1c1
Sequence:CCGGCGTAGACTTTATCAACGAGTACTCGAGTACTCGTTGATAAAGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152436.1-1457s1c1
Sequence:CCGGCCATGTGTTCTCATTGTTCAACTCGAGTTGAACAATGAGAACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152436.1-1309s1c1
Sequence:CCGGGCAGGTTTGTTACATAGGTATCTCGAGATACCTATGTAACAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152436.1-324s1c1
Sequence:CCGGGTACAAATGGTCCATCCTAAACTCGAGTTTAGGATGGACCATTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152436.1-930s21c1
Sequence:CCGGACTAACAGTTATACCCTTAAACTCGAGTTTAAGGGTATAACTGTTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152436.1-780s21c1
Sequence:CCGGTTTGATCAGAATGCTACTATTCTCGAGAATAGTAGCATTCTGATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152436.1-385s21c1
Sequence:CCGGATGAATTTACTGCAAGTATTGCTCGAGCAATACTTGCAGTAAATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152436.1-994s21c1
Sequence:CCGGACTGCTTTAAAGGATAGTATACTCGAGTATACTATCCTTTAAAGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026223
GLIPR1L2 MISSION shRNA Bacterial Glycerol Stock
GLI pathogenesis-related 1 like 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026223.1-813s1c1
Sequence:CCGGCTGCTATGTGTCATTGTCGTTCTCGAGAACGACAATGACACATAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026223.1-623s1c1
Sequence:CCGGGCCTTATCAAGCAGGGCAATTCTCGAGAATTGCCCTGCTTGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026223.1-1616s1c1
Sequence:CCGGCCCTTGTGTTAGAAGATTTATCTCGAGATAAATCTTCTAACACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026223.1-476s1c1
Sequence:CCGGCCAGAACTGTTCTCATTACATCTCGAGATGTAATGAGAACAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026223.1-847s1c1
Sequence:CCGGCCAGGTTTCCAGTTATCTTAACTCGAGTTAAGATAACTGGAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026223.2-246s21c1
Sequence:CCGGTGACTTGGGATGTAGCTTTATCTCGAGATAAAGCTACATCCCAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026223.2-295s21c1
Sequence:CCGGATGTATGTATAGCCGTAATACCTCGAGGTATTACGGCTATACATACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026223.2-52s21c1
Sequence:CCGGATGGCGTGCCCAGTCGAATTACTCGAGTAATTCGACTGGGCACGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026223.2-764s21c1
Sequence:CCGGTGTAATCCAATGTGCATATTTCTCGAGAAATATGCACATTGGATTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026223
GLIPR1L2 MISSION shRNA shRNA Plasmid DNA
GLI pathogenesis-related 1 like 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026223.1-813s1c1
Sequence:CCGGCTGCTATGTGTCATTGTCGTTCTCGAGAACGACAATGACACATAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026223.1-623s1c1
Sequence:CCGGGCCTTATCAAGCAGGGCAATTCTCGAGAATTGCCCTGCTTGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026223.1-1616s1c1
Sequence:CCGGCCCTTGTGTTAGAAGATTTATCTCGAGATAAATCTTCTAACACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026223.1-476s1c1
Sequence:CCGGCCAGAACTGTTCTCATTACATCTCGAGATGTAATGAGAACAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026223.1-847s1c1
Sequence:CCGGCCAGGTTTCCAGTTATCTTAACTCGAGTTAAGATAACTGGAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026223.2-246s21c1
Sequence:CCGGTGACTTGGGATGTAGCTTTATCTCGAGATAAAGCTACATCCCAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026223.2-295s21c1
Sequence:CCGGATGTATGTATAGCCGTAATACCTCGAGGTATTACGGCTATACATACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026223.2-52s21c1
Sequence:CCGGATGGCGTGCCCAGTCGAATTACTCGAGTAATTCGACTGGGCACGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026223.2-764s21c1
Sequence:CCGGTGTAATCCAATGTGCATATTTCTCGAGAAATATGCACATTGGATTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026223
GLIPR1L2 MISSION shRNA Lentiviral Transduction Particles
GLI pathogenesis-related 1 like 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026223.1-813s1c1
Sequence:CCGGCTGCTATGTGTCATTGTCGTTCTCGAGAACGACAATGACACATAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026223.1-623s1c1
Sequence:CCGGGCCTTATCAAGCAGGGCAATTCTCGAGAATTGCCCTGCTTGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026223.1-1616s1c1
Sequence:CCGGCCCTTGTGTTAGAAGATTTATCTCGAGATAAATCTTCTAACACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026223.1-476s1c1
Sequence:CCGGCCAGAACTGTTCTCATTACATCTCGAGATGTAATGAGAACAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026223.1-847s1c1
Sequence:CCGGCCAGGTTTCCAGTTATCTTAACTCGAGTTAAGATAACTGGAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026223.2-246s21c1
Sequence:CCGGTGACTTGGGATGTAGCTTTATCTCGAGATAAAGCTACATCCCAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026223.2-295s21c1
Sequence:CCGGATGTATGTATAGCCGTAATACCTCGAGGTATTACGGCTATACATACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026223.2-52s21c1
Sequence:CCGGATGGCGTGCCCAGTCGAATTACTCGAGTAATTCGACTGGGCACGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026223.2-764s21c1
Sequence:CCGGTGTAATCCAATGTGCATATTTCTCGAGAAATATGCACATTGGATTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks