EMAIL THIS PAGE TO A FRIEND

GLIPR2

GLI pathogenesis-related 2

172 Gene Product Result for
Synonyms: C9orf19 GAPR-1 GAPR1
UniProtKB ID: Q9H4G4, Q5VZR1, Q8N2S6, Q8WWC9, Q8WX36
Gene ID:
Mouse(384009) GLI pathogenesis-related 2
Rat(679819) GLI pathogenesis-related 2
sheep(101106830) GLI pathogenesis-related 2
domestic guinea pig(100730825) GLI pathogenesis-related 2
naked mole-rat(101709853) GLI pathogenesis-related 2
Zebrafish(325699) GLI pathogenesis-related 2
cow(538565) GLI pathogenesis-related 2
domestic cat(101097024) GLI pathogenesis-related 2
dog(611995) GLI pathogenesis-related 2
chicken(420999) GLI pathogenesis-related 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022343 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027450 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027450 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027450 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022343 Rosetta Predictions human pricing
XM_001054584 Rosetta Predictions rat pricing
NM_027450 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080385 predicted 279
2 SASI_Hs01_00080386 predicted 390
3 SASI_Hs01_00080387 predicted 498
4 SASI_Hs01_00080388 predicted 331
5 SASI_Hs01_00080389 predicted 255
6 SASI_Hs01_00080390 predicted 273
7 SASI_Hs01_00080391 predicted 520
8 SASI_Hs01_00080394 predicted 485
9 SASI_Hs02_00355625 predicted 240
10 SASI_Hs02_00355626 predicted 708
11 SASI_Hs01_00080392 predicted 886
12 SASI_Hs01_00080393 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276343 predicted 439
2 SASI_Rn02_00276344 predicted 606
3 SASI_Rn02_00276345 predicted 312
4 SASI_Rn02_00276346 predicted 478
5 SASI_Rn02_00276347 predicted 472
6 SASI_Rn02_00276348 predicted 371
7 SASI_Rn02_00276349 predicted 446
8 SASI_Rn02_00276350 predicted 594
9 SASI_Rn02_00276351 predicted 646
10 SASI_Rn02_00276352 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332211 predicted 266
2 SASI_Mm01_00180698 predicted 298
3 SASI_Mm02_00332212 predicted 297
4 SASI_Mm01_00180700 predicted 364
5 SASI_Mm01_00180703 predicted 522
6 SASI_Mm01_00180704 predicted 232
7 SASI_Mm02_00332213 predicted 358
8 SASI_Mm02_00332214 predicted 428
9 SASI_Mm02_00332215 predicted 478
10 SASI_Mm02_00332216 predicted 297
11 SASI_Mm01_00180699 predicted 267
12 SASI_Mm01_00180701 predicted 347
13 SASI_Mm01_00180702 predicted 310
14 SASI_Mm01_00180705 predicted 235
15 SASI_Mm01_00180706 predicted 462
16 SASI_Mm01_00180707 predicted 637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022343
VALIDATED
GLIPR2 MISSION shRNA Bacterial Glycerol Stock
GLI pathogenesis-related 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_022343.2-413s21c1
Sequence:CCGGTCCTTTGTGGTGGCCAGATACCTCGAGGTATCTGGCCACCACAAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_022343.2-231s21c1
Sequence:CCGGACCTTGCATGGGCATCCTATGCTCGAGCATAGGATGCCCATGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_022343.2-860s21c1
Sequence:CCGGGCTGAGAAGTGAAGTTCATTTCTCGAGAAATGAACTTCACTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_022343.2-524s21c1
Sequence:CCGGGCAGACTTAAGAACGTGGATACTCGAGTATCCACGTTCTTAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022343.2-487s21c1
Sequence:CCGGGCCGAAGAAGTAACTTGTTAACTCGAGTTAACAAGTTACTTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022343.2-295s1c1
Sequence:CCGGCAAGAACTATAACTTCCAGCACTCGAGTGCTGGAAGTTATAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022343.2-1104s1c1
Sequence:CCGGGCCAAACAACAAATGGAGAAACTCGAGTTTCTCCATTTGTTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_022343.2-860s1c1
Sequence:CCGGGCTGAGAAGTGAAGTTCATTTCTCGAGAAATGAACTTCACTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022343.2-242s1c1
Sequence:CCGGGCATCCTATGATCAGACAGGACTCGAGTCCTGTCTGATCATAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129248    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022343.2-1103s1c1
Sequence:CCGGCGCCAAACAACAAATGGAGAACTCGAGTTCTCCATTTGTTGTTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_022343.2-524s1c1
Sequence:CCGGGCAGACTTAAGAACGTGGATACTCGAGTATCCACGTTCTTAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022343.2-445s1c1
Sequence:CCGGGAATGTTGTCAATGAGGGCTTCTCGAGAAGCCCTCATTGACAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022343
VALIDATED
GLIPR2 MISSION shRNA shRNA Plasmid DNA
GLI pathogenesis-related 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_022343.2-413s21c1
Sequence:CCGGTCCTTTGTGGTGGCCAGATACCTCGAGGTATCTGGCCACCACAAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_022343.2-231s21c1
Sequence:CCGGACCTTGCATGGGCATCCTATGCTCGAGCATAGGATGCCCATGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_022343.2-860s21c1
Sequence:CCGGGCTGAGAAGTGAAGTTCATTTCTCGAGAAATGAACTTCACTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_022343.2-524s21c1
Sequence:CCGGGCAGACTTAAGAACGTGGATACTCGAGTATCCACGTTCTTAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022343.2-487s21c1
Sequence:CCGGGCCGAAGAAGTAACTTGTTAACTCGAGTTAACAAGTTACTTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022343.2-295s1c1
Sequence:CCGGCAAGAACTATAACTTCCAGCACTCGAGTGCTGGAAGTTATAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022343.2-1104s1c1
Sequence:CCGGGCCAAACAACAAATGGAGAAACTCGAGTTTCTCCATTTGTTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_022343.2-860s1c1
Sequence:CCGGGCTGAGAAGTGAAGTTCATTTCTCGAGAAATGAACTTCACTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022343.2-242s1c1
Sequence:CCGGGCATCCTATGATCAGACAGGACTCGAGTCCTGTCTGATCATAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129248    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022343.2-1103s1c1
Sequence:CCGGCGCCAAACAACAAATGGAGAACTCGAGTTCTCCATTTGTTGTTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_022343.2-524s1c1
Sequence:CCGGGCAGACTTAAGAACGTGGATACTCGAGTATCCACGTTCTTAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022343.2-445s1c1
Sequence:CCGGGAATGTTGTCAATGAGGGCTTCTCGAGAAGCCCTCATTGACAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022343
VALIDATED
GLIPR2 MISSION shRNA Lentiviral Transduction Particles
GLI pathogenesis-related 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_022343.2-413s21c1
Sequence:CCGGTCCTTTGTGGTGGCCAGATACCTCGAGGTATCTGGCCACCACAAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_022343.2-231s21c1
Sequence:CCGGACCTTGCATGGGCATCCTATGCTCGAGCATAGGATGCCCATGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_022343.2-860s21c1
Sequence:CCGGGCTGAGAAGTGAAGTTCATTTCTCGAGAAATGAACTTCACTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_022343.2-524s21c1
Sequence:CCGGGCAGACTTAAGAACGTGGATACTCGAGTATCCACGTTCTTAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022343.2-487s21c1
Sequence:CCGGGCCGAAGAAGTAACTTGTTAACTCGAGTTAACAAGTTACTTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022343.2-295s1c1
Sequence:CCGGCAAGAACTATAACTTCCAGCACTCGAGTGCTGGAAGTTATAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022343.2-1104s1c1
Sequence:CCGGGCCAAACAACAAATGGAGAAACTCGAGTTTCTCCATTTGTTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_022343.2-860s1c1
Sequence:CCGGGCTGAGAAGTGAAGTTCATTTCTCGAGAAATGAACTTCACTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022343.2-242s1c1
Sequence:CCGGGCATCCTATGATCAGACAGGACTCGAGTCCTGTCTGATCATAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129248    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022343.2-1103s1c1
Sequence:CCGGCGCCAAACAACAAATGGAGAACTCGAGTTCTCCATTTGTTGTTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_022343.2-524s1c1
Sequence:CCGGGCAGACTTAAGAACGTGGATACTCGAGTATCCACGTTCTTAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022343.2-445s1c1
Sequence:CCGGGAATGTTGTCAATGAGGGCTTCTCGAGAAGCCCTCATTGACAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027450
VALIDATED
GLIPR2 MISSION shRNA Bacterial Glycerol Stock
GLI pathogenesis-related 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027450.2-1740s1c1
Sequence:CCGGCGCTAATTTGATCCTGTGTTTCTCGAGAAACACAGGATCAAATTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027450.2-373s1c1
Sequence:CCGGCAGCCATGGTATGGAAGAATACTCGAGTATTCTTCCATACCATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027450.2-483s1c1
Sequence:CCGGCAGGGCTTCTTCGAAGAGAATCTCGAGATTCTCTTCGAAGAAGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027450.2-268s1c1
Sequence:CCGGCGTCTTATGATCAGACAGGAACTCGAGTTCCTGTCTGATCATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027450.2-314s1c1
Sequence:CCGGCGAAATCAAGAGCTACAACTTCTCGAGAAGTTGTAGCTCTTGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027450
VALIDATED
GLIPR2 MISSION shRNA shRNA Plasmid DNA
GLI pathogenesis-related 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027450.2-1740s1c1
Sequence:CCGGCGCTAATTTGATCCTGTGTTTCTCGAGAAACACAGGATCAAATTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027450.2-373s1c1
Sequence:CCGGCAGCCATGGTATGGAAGAATACTCGAGTATTCTTCCATACCATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027450.2-483s1c1
Sequence:CCGGCAGGGCTTCTTCGAAGAGAATCTCGAGATTCTCTTCGAAGAAGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027450.2-268s1c1
Sequence:CCGGCGTCTTATGATCAGACAGGAACTCGAGTTCCTGTCTGATCATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027450.2-314s1c1
Sequence:CCGGCGAAATCAAGAGCTACAACTTCTCGAGAAGTTGTAGCTCTTGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027450
VALIDATED
GLIPR2 MISSION shRNA Lentiviral Transduction Particles
GLI pathogenesis-related 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027450.2-1740s1c1
Sequence:CCGGCGCTAATTTGATCCTGTGTTTCTCGAGAAACACAGGATCAAATTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027450.2-373s1c1
Sequence:CCGGCAGCCATGGTATGGAAGAATACTCGAGTATTCTTCCATACCATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027450.2-483s1c1
Sequence:CCGGCAGGGCTTCTTCGAAGAGAATCTCGAGATTCTCTTCGAAGAAGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027450.2-268s1c1
Sequence:CCGGCGTCTTATGATCAGACAGGAACTCGAGTTCCTGTCTGATCATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027450.2-314s1c1
Sequence:CCGGCGAAATCAAGAGCTACAACTTCTCGAGAAGTTGTAGCTCTTGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks