EMAIL THIS PAGE TO A FRIEND

GLIS1

GLIS family zinc finger 1

77 Gene Product Result for
UniProtKB ID: Q8NBF1, Q2M3G9, Q8N9V9
Gene ID:
Human(148979) Summary: GLIS1 is a GLI (MIM 165220)-related Kruppel-like zinc finger protein that functions as an activator and repressor of transcription (Kim et al., 2002 [PubMed 12042312]
Mouse(230587) GLIS family zinc finger 1
Rat(298732) GLIS family zinc finger 1
chicken(424652) GLIS family zinc finger 1
domestic cat(101094280) GLIS family zinc finger 1
dog(489582) GLIS family zinc finger 1
cow(541222) GLIS family zinc finger 1
domestic guinea pig(100716697) GLIS family zinc finger 1
naked mole-rat(101708114) GLIS family zinc finger 1
sheep(101117210) GLIS family zinc finger 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_147193 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147193 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147193 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_147221 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_147221 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_147221 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_147193 Rosetta Predictions human pricing
NM_001106703 Rosetta Predictions rat pricing
NM_147221 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180637 predicted 1599
2 SASI_Hs01_00180638 predicted 1346
3 SASI_Hs01_00180641 predicted 575
4 SASI_Hs01_00180642 predicted 1004
5 SASI_Hs02_00365535 predicted 743
6 SASI_Hs01_00180643 predicted 1760
7 SASI_Hs01_00180644 predicted 1532
8 SASI_Hs02_00365536 predicted 851
9 SASI_Hs01_00180645 predicted 1516
10 SASI_Hs01_00180646 predicted 2101
11 SASI_Hs01_00180639 predicted 855
12 SASI_Hs01_00180640 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106703 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221558 predicted 249
2 SASI_Rn02_00221559 predicted 354
3 SASI_Rn02_00221560 predicted 317
4 SASI_Rn02_00221561 predicted 321
5 SASI_Rn02_00221562 predicted 326
6 SASI_Rn02_00221563 predicted 207
7 SASI_Rn02_00221564 predicted 331
8 SASI_Rn02_00221565 predicted 350
9 SASI_Rn02_00221566 predicted 332
10 SASI_Rn02_00221567 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147221 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047215 predicted 1513
2 SASI_Mm01_00047216 predicted 822
3 SASI_Mm01_00047217 predicted 2566
4 SASI_Mm01_00047218 predicted 857
5 SASI_Mm01_00047219 predicted 1410
6 SASI_Mm01_00047220 predicted 1457
7 SASI_Mm01_00047222 predicted 2537
8 SASI_Mm01_00047223 predicted 1526
9 SASI_Mm01_00047224 predicted 2259
10 SASI_Mm02_00342709 predicted 1817
11 SASI_Mm01_00047221 predicted 2365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147193
GLIS1 MISSION shRNA Bacterial Glycerol Stock
GLIS family zinc finger 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147193.1-2650s1c1
Sequence:CCGGGCCCTGTAACATTCCCTCGATCTCGAGATCGAGGGAATGTTACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147193.1-1347s1c1
Sequence:CCGGCCCAACAAGTGCATGTTTGAACTCGAGTTCAAACATGCACTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147193.1-1511s1c1
Sequence:CCGGCCACCTAGACACGAAGCCGTACTCGAGTACGGCTTCGTGTCTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147193.1-2108s1c1
Sequence:CCGGCCAGGGCAGTTTCCACTCCATCTCGAGATGGAGTGGAAACTGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147193.1-851s1c1
Sequence:CCGGGTCTCTGGTCACCTGTGTAAACTCGAGTTTACACAGGTGACCAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147193.2-2411s21c1
Sequence:CCGGCCATCTACACAGACACCTGAACTCGAGTTCAGGTGTCTGTGTAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147193
GLIS1 MISSION shRNA shRNA Plasmid DNA
GLIS family zinc finger 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147193.1-2650s1c1
Sequence:CCGGGCCCTGTAACATTCCCTCGATCTCGAGATCGAGGGAATGTTACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147193.1-1347s1c1
Sequence:CCGGCCCAACAAGTGCATGTTTGAACTCGAGTTCAAACATGCACTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147193.1-1511s1c1
Sequence:CCGGCCACCTAGACACGAAGCCGTACTCGAGTACGGCTTCGTGTCTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147193.1-2108s1c1
Sequence:CCGGCCAGGGCAGTTTCCACTCCATCTCGAGATGGAGTGGAAACTGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147193.1-851s1c1
Sequence:CCGGGTCTCTGGTCACCTGTGTAAACTCGAGTTTACACAGGTGACCAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147193.2-2411s21c1
Sequence:CCGGCCATCTACACAGACACCTGAACTCGAGTTCAGGTGTCTGTGTAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147193
GLIS1 MISSION shRNA Lentiviral Transduction Particles
GLIS family zinc finger 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147193.1-2650s1c1
Sequence:CCGGGCCCTGTAACATTCCCTCGATCTCGAGATCGAGGGAATGTTACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147193.1-1347s1c1
Sequence:CCGGCCCAACAAGTGCATGTTTGAACTCGAGTTCAAACATGCACTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147193.1-1511s1c1
Sequence:CCGGCCACCTAGACACGAAGCCGTACTCGAGTACGGCTTCGTGTCTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147193.1-2108s1c1
Sequence:CCGGCCAGGGCAGTTTCCACTCCATCTCGAGATGGAGTGGAAACTGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147193.1-851s1c1
Sequence:CCGGGTCTCTGGTCACCTGTGTAAACTCGAGTTTACACAGGTGACCAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147193.2-2411s21c1
Sequence:CCGGCCATCTACACAGACACCTGAACTCGAGTTCAGGTGTCTGTGTAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147221
VALIDATED
GLIS1 MISSION shRNA Bacterial Glycerol Stock
GLIS family zinc finger 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147221.1-2637s1c1
Sequence:CCGGCTCTCCATAAGGTTCTCAAATCTCGAGATTTGAGAACCTTATGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147221.1-884s1c1
Sequence:CCGGGCTGTGTAAATGGACTCCGAACTCGAGTTCGGAGTCCATTTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147221.1-872s1c1
Sequence:CCGGCAGCTCTAGTTAGCTGTGTAACTCGAGTTACACAGCTAACTAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147221.1-871s1c1
Sequence:CCGGACAGCTCTAGTTAGCTGTGTACTCGAGTACACAGCTAACTAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_147221.1-2130s1c1
Sequence:CCGGCAGTTTCCATTCCATCCAGAACTCGAGTTCTGGATGGAATGGAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147221.2-976s21c1
Sequence:CCGGGTGCCTCCTCAGATATCAATCCTCGAGGATTGATATCTGAGGAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147221.2-847s21c1
Sequence:CCGGGCTACCTTCTGGGCAATGAACCTCGAGGTTCATTGCCCAGAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147221
VALIDATED
GLIS1 MISSION shRNA shRNA Plasmid DNA
GLIS family zinc finger 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147221.1-2637s1c1
Sequence:CCGGCTCTCCATAAGGTTCTCAAATCTCGAGATTTGAGAACCTTATGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147221.1-884s1c1
Sequence:CCGGGCTGTGTAAATGGACTCCGAACTCGAGTTCGGAGTCCATTTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147221.1-872s1c1
Sequence:CCGGCAGCTCTAGTTAGCTGTGTAACTCGAGTTACACAGCTAACTAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147221.1-871s1c1
Sequence:CCGGACAGCTCTAGTTAGCTGTGTACTCGAGTACACAGCTAACTAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_147221.1-2130s1c1
Sequence:CCGGCAGTTTCCATTCCATCCAGAACTCGAGTTCTGGATGGAATGGAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147221.2-976s21c1
Sequence:CCGGGTGCCTCCTCAGATATCAATCCTCGAGGATTGATATCTGAGGAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147221.2-847s21c1
Sequence:CCGGGCTACCTTCTGGGCAATGAACCTCGAGGTTCATTGCCCAGAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147221
VALIDATED
GLIS1 MISSION shRNA Lentiviral Transduction Particles
GLIS family zinc finger 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147221.1-2637s1c1
Sequence:CCGGCTCTCCATAAGGTTCTCAAATCTCGAGATTTGAGAACCTTATGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147221.1-884s1c1
Sequence:CCGGGCTGTGTAAATGGACTCCGAACTCGAGTTCGGAGTCCATTTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147221.1-872s1c1
Sequence:CCGGCAGCTCTAGTTAGCTGTGTAACTCGAGTTACACAGCTAACTAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147221.1-871s1c1
Sequence:CCGGACAGCTCTAGTTAGCTGTGTACTCGAGTACACAGCTAACTAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_147221.1-2130s1c1
Sequence:CCGGCAGTTTCCATTCCATCCAGAACTCGAGTTCTGGATGGAATGGAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147221.2-976s21c1
Sequence:CCGGGTGCCTCCTCAGATATCAATCCTCGAGGATTGATATCTGAGGAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147221.2-847s21c1
Sequence:CCGGGCTACCTTCTGGGCAATGAACCTCGAGGTTCATTGCCCAGAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks