EMAIL THIS PAGE TO A FRIEND

GLIS2

GLIS family zinc finger 2

56 Gene Product Result for
Synonyms: NKL NPHP7
UniProtKB ID: Q9BZE0, B3KX84
Gene ID:
Human(84662) Summary: This gene is a member of the GLI-similar zinc finger protein family and encodes a nuclear transcription factor with five C2H2-type zinc finger domains. The protein encoded by this gene is widely expressed at low levels in the neural tube and peripheral nervous system and likely promotes neuronal differentiation. It is abundantly expressed in the kidney and may have a role in the regulation of kidney morphogenesis. p120 regulates the expression level of this protein and induces the cleavage of this protein's C-terminal zinc finger domain. This protein also promotes the nuclear translocation of p120. Mutations in this gene cause nephronophthisis (NPHP), an autosomal recessive kidney disease characterized by tubular basement membrane disruption, interstitial lymphohistiocytic cell infiltration, and development of cysts at the corticomedullary border of the kidneys.[provided by RefSeq, Jan 2010]
Mouse(83396) GLIS family zinc finger 2
Rat(302946) GLIS family zinc finger 2
sheep(101102282) GLIS family zinc finger 2
domestic guinea pig(100718347) GLIS family zinc finger 2
naked mole-rat(101718299) GLIS family zinc finger 2
chicken(374023) GLIS family zinc finger 2
dog(490028) GLIS family zinc finger 2
domestic cat(101095217) GLIS family zinc finger 2
Horse(100066071) GLIS family zinc finger 2
cow(527935) GLIS family zinc finger 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV30037 Anti-GLIS2 antibody produced in rabbit affinity isolated antibody canine, human, horse, rat, bovine, mouse, guinea pig, zebrafish, rabbit
western blot pricing
AV30036 Anti-GLIS2 antibody produced in rabbit IgG fraction of antiserum canine, rabbit, human, rat, mouse, guinea pig, horse
western blot pricing
HPA056976 Anti-GLIS2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032575 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031184 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031184 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031184 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030211 MISSION® esiRNA esiRNA human GLIS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032575 Rosetta Predictions human pricing
NM_001106978 Rosetta Predictions rat pricing
NM_031184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360095 predicted 1760
2 SASI_Hs01_00031359 predicted 691
3 SASI_Hs01_00031360 predicted 707
4 SASI_Hs02_00360096 predicted 1692
5 SASI_Hs01_00031361 predicted 857
6 SASI_Hs01_00031362 predicted 881
7 SASI_Hs01_00031364 predicted 1626
8 SASI_Hs01_00031366 predicted 885
9 SASI_Hs01_00031368 predicted 573
10 SASI_Hs02_00360097 predicted 594
11 SASI_Hs01_00031363 predicted 406
12 SASI_Hs01_00031365 predicted 882
13 SASI_Hs01_00031367 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224286 predicted 1673
2 SASI_Rn02_00224287 predicted 1946
3 SASI_Rn02_00224288 predicted 1697
4 SASI_Rn02_00224289 predicted 795
5 SASI_Rn02_00224290 predicted 1764
6 SASI_Rn02_00224291 predicted 1764
7 SASI_Rn02_00224292 predicted 947
8 SASI_Rn02_00224293 predicted 2114
9 SASI_Rn02_00224294 predicted 2142
10 SASI_Rn02_00224295 predicted 1674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129278 predicted 2067
2 SASI_Mm01_00129279 predicted 1915
3 SASI_Mm01_00129280 predicted 1215
4 SASI_Mm01_00129281 predicted 1834
5 SASI_Mm01_00129282 predicted 1105
6 SASI_Mm01_00129283 predicted 1696
7 SASI_Mm02_00337026 predicted 1975
8 SASI_Mm01_00129284 predicted 2217
9 SASI_Mm01_00129285 predicted 1290
10 SASI_Mm01_00129286 predicted 1899
11 SASI_Mm01_00129287 predicted 1084
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032575
GLIS2 MISSION shRNA Bacterial Glycerol Stock
GLIS family zinc finger 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032575.2-1765s21c1
Sequence:CCGGGGATGGTGCTAGGTCATTCATCTCGAGATGAATGACCTAGCACCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032575.2-920s21c1
Sequence:CCGGATGTGGACAAGCCCTACTACTCTCGAGAGTAGTAGGGCTTGTCCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032575.1-735s1c1
Sequence:CCGGCCGCACACACACCAACGAGAACTCGAGTTCTCGTTGGTGTGTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032575.1-1278s1c1
Sequence:CCGGGCCTCTCAATCTGGCCAAGAACTCGAGTTCTTGGCCAGATTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032575.1-696s1c1
Sequence:CCGGCCGAGGTTTCAACGCCAGGTACTCGAGTACCTGGCGTTGAAACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032575.1-1693s1c1
Sequence:CCGGCGGAAACTCTTCTGTGAAATACTCGAGTATTTCACAGAAGAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032575.1-616s1c1
Sequence:CCGGGACCATGTCAACGATTACCATCTCGAGATGGTAATCGTTGACATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032575
GLIS2 MISSION shRNA shRNA Plasmid DNA
GLIS family zinc finger 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032575.2-1765s21c1
Sequence:CCGGGGATGGTGCTAGGTCATTCATCTCGAGATGAATGACCTAGCACCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032575.2-920s21c1
Sequence:CCGGATGTGGACAAGCCCTACTACTCTCGAGAGTAGTAGGGCTTGTCCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032575.1-735s1c1
Sequence:CCGGCCGCACACACACCAACGAGAACTCGAGTTCTCGTTGGTGTGTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032575.1-1278s1c1
Sequence:CCGGGCCTCTCAATCTGGCCAAGAACTCGAGTTCTTGGCCAGATTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032575.1-696s1c1
Sequence:CCGGCCGAGGTTTCAACGCCAGGTACTCGAGTACCTGGCGTTGAAACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032575.1-1693s1c1
Sequence:CCGGCGGAAACTCTTCTGTGAAATACTCGAGTATTTCACAGAAGAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032575.1-616s1c1
Sequence:CCGGGACCATGTCAACGATTACCATCTCGAGATGGTAATCGTTGACATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032575
GLIS2 MISSION shRNA Lentiviral Transduction Particles
GLIS family zinc finger 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032575.2-1765s21c1
Sequence:CCGGGGATGGTGCTAGGTCATTCATCTCGAGATGAATGACCTAGCACCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032575.2-920s21c1
Sequence:CCGGATGTGGACAAGCCCTACTACTCTCGAGAGTAGTAGGGCTTGTCCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032575.1-735s1c1
Sequence:CCGGCCGCACACACACCAACGAGAACTCGAGTTCTCGTTGGTGTGTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032575.1-1278s1c1
Sequence:CCGGGCCTCTCAATCTGGCCAAGAACTCGAGTTCTTGGCCAGATTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032575.1-696s1c1
Sequence:CCGGCCGAGGTTTCAACGCCAGGTACTCGAGTACCTGGCGTTGAAACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032575.1-1693s1c1
Sequence:CCGGCGGAAACTCTTCTGTGAAATACTCGAGTATTTCACAGAAGAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032575.1-616s1c1
Sequence:CCGGGACCATGTCAACGATTACCATCTCGAGATGGTAATCGTTGACATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031184
VALIDATED
GLIS2 MISSION shRNA Bacterial Glycerol Stock
GLIS family zinc finger 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031184.3-1906s21c1
Sequence:CCGGAGAAACTCTTCTGCGAAATAGCTCGAGCTATTTCGCAGAAGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031184.3-843s21c1
Sequence:CCGGGACCATCATGTCAAGCCTGAACTCGAGTTCAGGCTTGACATGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031184.3-789s21c1
Sequence:CCGGGCCAAGTGTAACCAGCTCTTTCTCGAGAAAGAGCTGGTTACACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031184.3-621s21c1
Sequence:CCGGTTCCAGCCACTTCGCTATTTGCTCGAGCAAATAGCGAAGTGGCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031184.3-924s21c1
Sequence:CCGGGCCAGGTACAAGATGCTCATTCTCGAGAATGAGCATCTTGTACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031184.1-843s1c1
Sequence:CCGGGACCATCATGTCAAGCCTGAACTCGAGTTCAGGCTTGACATGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031184.1-789s1c1
Sequence:CCGGGCCAAGTGTAACCAGCTCTTTCTCGAGAAAGAGCTGGTTACACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031184.1-1800s1c1
Sequence:CCGGCCAGGGTCTGTGCTGCTCAAACTCGAGTTTGAGCAGCACAGACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031184.1-299s1c1
Sequence:CCGGCCTAAAGCTGAGCATCACCAACTCGAGTTGGTGATGCTCAGCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031184.1-924s1c1
Sequence:CCGGGCCAGGTACAAGATGCTCATTCTCGAGAATGAGCATCTTGTACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031184
VALIDATED
GLIS2 MISSION shRNA shRNA Plasmid DNA
GLIS family zinc finger 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031184.3-1906s21c1
Sequence:CCGGAGAAACTCTTCTGCGAAATAGCTCGAGCTATTTCGCAGAAGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031184.3-843s21c1
Sequence:CCGGGACCATCATGTCAAGCCTGAACTCGAGTTCAGGCTTGACATGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031184.3-789s21c1
Sequence:CCGGGCCAAGTGTAACCAGCTCTTTCTCGAGAAAGAGCTGGTTACACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031184.3-621s21c1
Sequence:CCGGTTCCAGCCACTTCGCTATTTGCTCGAGCAAATAGCGAAGTGGCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031184.3-924s21c1
Sequence:CCGGGCCAGGTACAAGATGCTCATTCTCGAGAATGAGCATCTTGTACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031184.1-843s1c1
Sequence:CCGGGACCATCATGTCAAGCCTGAACTCGAGTTCAGGCTTGACATGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031184.1-789s1c1
Sequence:CCGGGCCAAGTGTAACCAGCTCTTTCTCGAGAAAGAGCTGGTTACACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031184.1-1800s1c1
Sequence:CCGGCCAGGGTCTGTGCTGCTCAAACTCGAGTTTGAGCAGCACAGACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031184.1-299s1c1
Sequence:CCGGCCTAAAGCTGAGCATCACCAACTCGAGTTGGTGATGCTCAGCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031184.1-924s1c1
Sequence:CCGGGCCAGGTACAAGATGCTCATTCTCGAGAATGAGCATCTTGTACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031184
VALIDATED
GLIS2 MISSION shRNA Lentiviral Transduction Particles
GLIS family zinc finger 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031184.3-1906s21c1
Sequence:CCGGAGAAACTCTTCTGCGAAATAGCTCGAGCTATTTCGCAGAAGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031184.3-843s21c1
Sequence:CCGGGACCATCATGTCAAGCCTGAACTCGAGTTCAGGCTTGACATGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031184.3-789s21c1
Sequence:CCGGGCCAAGTGTAACCAGCTCTTTCTCGAGAAAGAGCTGGTTACACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031184.3-621s21c1
Sequence:CCGGTTCCAGCCACTTCGCTATTTGCTCGAGCAAATAGCGAAGTGGCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031184.3-924s21c1
Sequence:CCGGGCCAGGTACAAGATGCTCATTCTCGAGAATGAGCATCTTGTACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031184.1-843s1c1
Sequence:CCGGGACCATCATGTCAAGCCTGAACTCGAGTTCAGGCTTGACATGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031184.1-789s1c1
Sequence:CCGGGCCAAGTGTAACCAGCTCTTTCTCGAGAAAGAGCTGGTTACACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031184.1-1800s1c1
Sequence:CCGGCCAGGGTCTGTGCTGCTCAAACTCGAGTTTGAGCAGCACAGACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031184.1-299s1c1
Sequence:CCGGCCTAAAGCTGAGCATCACCAACTCGAGTTGGTGATGCTCAGCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031184.1-924s1c1
Sequence:CCGGGCCAGGTACAAGATGCTCATTCTCGAGAATGAGCATCTTGTACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks