EMAIL THIS PAGE TO A FRIEND

GLIS3

GLIS family zinc finger 3

199 Gene Product Result for
Synonyms: ZNF515
UniProtKB ID: Q8NEA6, B1AL19, Q1PHK5
Gene ID:
Human(169792) Summary: This gene is a member of the GLI-similar zinc finger protein family and encodes a nuclear protein with five C2H2-type zinc finger domains. This protein functions as both a repressor and activator of transcription and is specifically involved in the development of pancreatic beta cells, the thyroid, eye, liver and kidney. Mutations in this gene have been associated with neonatal diabetes and congenital hypothyroidism (NDH). Alternatively spliced variants that encode different protein isoforms have been described but the full-length nature of only two have been determined. [provided by RefSeq, Jul 2008]
Mouse(226075) GLIS family zinc finger 3
Rat(680671) GLIS family zinc finger 3
Zebrafish(571000) GLIS family zinc finger 3
cow(524909) GLIS family zinc finger 3
Horse(100051202) GLIS family zinc finger 3
domestic cat(101100094) GLIS family zinc finger 3
dog(484179) GLIS family zinc finger 3
chicken(431643) GLIS family zinc finger 3
domestic guinea pig(100721533) GLIS family zinc finger 3
naked mole-rat(101712203) GLIS family zinc finger 3
sheep(101111939) GLIS family zinc finger 3
Domestic Rabbit(100351970) GLIS family zinc finger 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152629 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152629 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152629 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175459 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175459 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175459 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042413 Rosetta Predictions human pricing
NM_152629 Rosetta Predictions human pricing
XM_001058298 Rosetta Predictions rat pricing
NM_175459 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309608 predicted 2519
2 SASI_Hs02_00309609 predicted 1644
3 SASI_Hs02_00309610 predicted 1494
4 SASI_Hs02_00309611 predicted 3362
5 SASI_Hs02_00309612 predicted 2572
6 SASI_Hs02_00309613 predicted 1304
7 SASI_Hs02_00309614 predicted 3355
8 SASI_Hs02_00309615 predicted 2965
9 SASI_Hs02_00309616 predicted 1434
10 SASI_Hs02_00309617 predicted 2353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174460 predicted 1533
2 SASI_Hs01_00174461 predicted 658
3 SASI_Hs01_00174462 predicted 513
4 SASI_Hs02_00366493 predicted 2381
5 SASI_Hs01_00174463 predicted 1593
6 SASI_Hs02_00366494 predicted 328
7 SASI_Hs01_00174464 predicted 2372
8 SASI_Hs01_00174465 predicted 1979
9 SASI_Hs01_00174466 predicted 451
10 SASI_Hs01_00174468 predicted 1364
11 SASI_Hs01_00174459 predicted 532
12 SASI_Hs01_00174467 predicted 1754
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058298 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289236 predicted 595
2 SASI_Rn02_00289237 predicted 739
3 SASI_Rn02_00289238 predicted 718
4 SASI_Rn02_00289239 predicted 470
5 SASI_Rn02_00289240 predicted 635
6 SASI_Rn02_00289241 predicted 485
7 SASI_Rn02_00289242 predicted 484
8 SASI_Rn02_00289243 predicted 622
9 SASI_Rn02_00289244 predicted 428
10 SASI_Rn02_00289245 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346361 predicted 3417
2 SASI_Mm01_00054536 predicted 2445
3 SASI_Mm01_00054537 predicted 1163
4 SASI_Mm01_00054538 predicted 1224
5 SASI_Mm01_00054540 predicted 2845
6 SASI_Mm01_00054541 predicted 1461
7 SASI_Mm02_00346362 predicted 720
8 SASI_Mm01_00054542 predicted 2729
9 SASI_Mm01_00054543 predicted 2217
10 SASI_Mm02_00346363 predicted 1955
11 SASI_Mm01_00054539 predicted 1494
12 SASI_Mm01_00054544 predicted 271
13 SASI_Mm01_00054545 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152629
VALIDATED
GLIS3 MISSION shRNA Bacterial Glycerol Stock
GLIS family zinc finger 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152629.2-2636s1c1
Sequence:CCGGGCAGAGTTACTGATGTTCTTTCTCGAGAAAGAACATCAGTAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_152629.2-2374s1c1
Sequence:CCGGCGGGCATTACAGTGTATGATTCTCGAGAATCATACACTGTAATGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152629.2-2156s1c1
Sequence:CCGGGCCAGAAACAAACTCTTCTTTCTCGAGAAAGAAGAGTTTGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152629.2-665s1c1
Sequence:CCGGCGGGATAGATTTCAATACCATCTCGAGATGGTATTGAAATCTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152629.2-1870s1c1
Sequence:CCGGCCAGCAATTATTCAAGCCGAACTCGAGTTCGGCTTGAATAATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152629.3-2923s21c1
Sequence:CCGGAGTGACCTGCCTCACCTAATCCTCGAGGATTAGGTGAGGCAGGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152629.3-317s21c1
Sequence:CCGGAGATACCAGGTCCCTTATTTCCTCGAGGAAATAAGGGACCTGGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152629
VALIDATED
GLIS3 MISSION shRNA shRNA Plasmid DNA
GLIS family zinc finger 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152629.2-2636s1c1
Sequence:CCGGGCAGAGTTACTGATGTTCTTTCTCGAGAAAGAACATCAGTAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_152629.2-2374s1c1
Sequence:CCGGCGGGCATTACAGTGTATGATTCTCGAGAATCATACACTGTAATGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152629.2-2156s1c1
Sequence:CCGGGCCAGAAACAAACTCTTCTTTCTCGAGAAAGAAGAGTTTGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152629.2-665s1c1
Sequence:CCGGCGGGATAGATTTCAATACCATCTCGAGATGGTATTGAAATCTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152629.2-1870s1c1
Sequence:CCGGCCAGCAATTATTCAAGCCGAACTCGAGTTCGGCTTGAATAATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152629.3-2923s21c1
Sequence:CCGGAGTGACCTGCCTCACCTAATCCTCGAGGATTAGGTGAGGCAGGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152629.3-317s21c1
Sequence:CCGGAGATACCAGGTCCCTTATTTCCTCGAGGAAATAAGGGACCTGGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152629
VALIDATED
GLIS3 MISSION shRNA Lentiviral Transduction Particles
GLIS family zinc finger 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152629.2-2636s1c1
Sequence:CCGGGCAGAGTTACTGATGTTCTTTCTCGAGAAAGAACATCAGTAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_152629.2-2374s1c1
Sequence:CCGGCGGGCATTACAGTGTATGATTCTCGAGAATCATACACTGTAATGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152629.2-2156s1c1
Sequence:CCGGGCCAGAAACAAACTCTTCTTTCTCGAGAAAGAAGAGTTTGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152629.2-665s1c1
Sequence:CCGGCGGGATAGATTTCAATACCATCTCGAGATGGTATTGAAATCTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152629.2-1870s1c1
Sequence:CCGGCCAGCAATTATTCAAGCCGAACTCGAGTTCGGCTTGAATAATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152629.3-2923s21c1
Sequence:CCGGAGTGACCTGCCTCACCTAATCCTCGAGGATTAGGTGAGGCAGGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152629.3-317s21c1
Sequence:CCGGAGATACCAGGTCCCTTATTTCCTCGAGGAAATAAGGGACCTGGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175459
VALIDATED
GLIS3 MISSION shRNA Bacterial Glycerol Stock
GLIS family zinc finger 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175459.3-1271s1c1
Sequence:CCGGCGCACGGTATAAACTGCTGATCTCGAGATCAGCAGTTTATACCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175459.3-563s1c1
Sequence:CCGGCGGGATCGACTTCAACACTATCTCGAGATAGTGTTGAAGTCGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175459.3-1780s1c1
Sequence:CCGGCCAGCAATCATTCAACTCGAACTCGAGTTCGAGTTGAATGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175459.3-1495s1c1
Sequence:CCGGCTAAACCTTATGCTTGTCAAACTCGAGTTTGACAAGCATAAGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175459.3-1494s1c1
Sequence:CCGGACTAAACCTTATGCTTGTCAACTCGAGTTGACAAGCATAAGGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175459
VALIDATED
GLIS3 MISSION shRNA shRNA Plasmid DNA
GLIS family zinc finger 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175459.3-1271s1c1
Sequence:CCGGCGCACGGTATAAACTGCTGATCTCGAGATCAGCAGTTTATACCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175459.3-563s1c1
Sequence:CCGGCGGGATCGACTTCAACACTATCTCGAGATAGTGTTGAAGTCGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175459.3-1780s1c1
Sequence:CCGGCCAGCAATCATTCAACTCGAACTCGAGTTCGAGTTGAATGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175459.3-1495s1c1
Sequence:CCGGCTAAACCTTATGCTTGTCAAACTCGAGTTTGACAAGCATAAGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175459.3-1494s1c1
Sequence:CCGGACTAAACCTTATGCTTGTCAACTCGAGTTGACAAGCATAAGGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175459
VALIDATED
GLIS3 MISSION shRNA Lentiviral Transduction Particles
GLIS family zinc finger 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175459.3-1271s1c1
Sequence:CCGGCGCACGGTATAAACTGCTGATCTCGAGATCAGCAGTTTATACCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175459.3-563s1c1
Sequence:CCGGCGGGATCGACTTCAACACTATCTCGAGATAGTGTTGAAGTCGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175459.3-1780s1c1
Sequence:CCGGCCAGCAATCATTCAACTCGAACTCGAGTTCGAGTTGAATGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175459.3-1495s1c1
Sequence:CCGGCTAAACCTTATGCTTGTCAAACTCGAGTTTGACAAGCATAAGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175459.3-1494s1c1
Sequence:CCGGACTAAACCTTATGCTTGTCAACTCGAGTTGACAAGCATAAGGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks