EMAIL THIS PAGE TO A FRIEND

GLMN

glomulin, FKBP associated protein

68 Gene Product Result for
Synonyms: FAP FAP48 FAP68 FKBPAP GLML GVM VMGLOM
UniProtKB ID: Q92990, Q5VVC3, Q9BVE8
Gene ID:
Human(11146) Summary: This gene encodes a phosphorylated protein that is a member of a Skp1-Cullin-F-box-like complex. The protein is essential for normal development of the vasculature and mutations in this gene have been associated with glomuvenous malformations, also called glomangiomas. Alternatively spliced variants that encode different protein isoforms have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
Mouse(170823) glomulin, FKBP associated protein
Rat(289437) glomulin, FKBP associated protein
chicken(424503) glomulin, FKBP associated protein
cow(504211) glomulin, FKBP associated protein
Horse(100051435) glomulin, FKBP associated protein
domestic cat(101086584) glomulin, FKBP associated protein
dog(479951) glomulin, FKBP associated protein
sheep(101103436) glomulin, FKBP associated protein
domestic guinea pig(100720755) glomulin, FKBP associated protein
naked mole-rat(101716333) glomulin, FKBP associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100926 Anti-GLMN (ab1) antibody produced in rabbit affinity isolated antibody guinea pig, horse, rabbit, human
western blot pricing
SAB2100927 Anti-GLMN (ab2) antibody produced in rabbit affinity isolated antibody bovine, human, canine, horse, mouse, rabbit, rat, guinea pig
western blot pricing
SAB1407108 Anti-GLMN antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA031446 Anti-GLMN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA031447 Anti-GLMN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA031448 Anti-GLMN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1410163 Anti-GLMN antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
WH0011146M1 Monoclonal Anti-GLMN antibody produced in mouse clone 1C12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404908 Monoclonal Anti-GLMN antibody produced in mouse clone 2B5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133248 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133248 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133248 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_053274 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053274 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053274 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053274 Rosetta Predictions human pricing
NM_001105993 Rosetta Predictions rat pricing
NM_133248 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021200 predicted 636
2 SASI_Hs01_00021201 predicted 1386
3 SASI_Hs01_00021202 predicted 617
4 SASI_Hs01_00021203 predicted 1144
5 SASI_Hs01_00021204 predicted 1265
6 SASI_Hs02_00361906 predicted 1002
7 SASI_Hs01_00021205 predicted 1446
8 SASI_Hs01_00021206 predicted 297
9 SASI_Hs01_00021208 predicted 1198
10 SASI_Hs01_00021209 predicted 961
11 SASI_Hs01_00021207 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105993 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214572 predicted 1094
2 SASI_Rn02_00214573 predicted 1662
3 SASI_Rn02_00214574 predicted 292
4 SASI_Rn02_00214575 predicted 1124
5 SASI_Rn02_00214576 predicted 1309
6 SASI_Rn02_00214577 predicted 487
7 SASI_Rn02_00214578 predicted 717
8 SASI_Rn02_00214579 predicted 827
9 SASI_Rn02_00214580 predicted 1321
10 SASI_Rn02_00214581 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169299 predicted 1240
2 SASI_Mm01_00169300 predicted 982
3 SASI_Mm01_00169301 predicted 339
4 SASI_Mm01_00169302 predicted 447
5 SASI_Mm01_00169303 predicted 1083
6 SASI_Mm01_00169304 predicted 250
7 SASI_Mm01_00169305 predicted 782
8 SASI_Mm01_00169306 predicted 1649
9 SASI_Mm01_00169307 predicted 597
10 SASI_Mm01_00169308 predicted 585
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133248
VALIDATED
GLMN MISSION shRNA Bacterial Glycerol Stock
glomulin, FKBP associated protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133248.2-1070s21c1
Sequence:CCGGAGTTGAACATGGAGCATATTGCTCGAGCAATATGCTCCATGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133248.2-1818s21c1
Sequence:CCGGCGCTCTCTTCACATTTGACTTCTCGAGAAGTCAAATGTGAAGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133248.2-557s21c1
Sequence:CCGGCCGTTGGACTAGCATTGTCAACTCGAGTTGACAATGCTAGTCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133248.2-1678s21c1
Sequence:CCGGGCACATTATGAAGCAGAAATTCTCGAGAATTTCTGCTTCATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133248.2-783s21c1
Sequence:CCGGCCCTTTGCTGACAGCACAATTCTCGAGAATTGTGCTGTCAGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133248.1-603s1c1
Sequence:CCGGGCCTTGATAGAGTTCACGAAACTCGAGTTTCGTGAACTCTATCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133248.1-1754s1c1
Sequence:CCGGCGCTCTCTTCACATTTGACTTCTCGAGAAGTCAAATGTGAAGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133248.1-1583s1c1
Sequence:CCGGGCCACTTCATATAGGACTTAACTCGAGTTAAGTCCTATATGAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133248.1-493s1c1
Sequence:CCGGCCGTTGGACTAGCATTGTCAACTCGAGTTGACAATGCTAGTCCAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133248.1-1614s1c1
Sequence:CCGGGCACATTATGAAGCAGAAATTCTCGAGAATTTCTGCTTCATAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133248
VALIDATED
GLMN MISSION shRNA shRNA Plasmid DNA
glomulin, FKBP associated protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133248.2-1070s21c1
Sequence:CCGGAGTTGAACATGGAGCATATTGCTCGAGCAATATGCTCCATGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133248.2-1818s21c1
Sequence:CCGGCGCTCTCTTCACATTTGACTTCTCGAGAAGTCAAATGTGAAGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133248.2-557s21c1
Sequence:CCGGCCGTTGGACTAGCATTGTCAACTCGAGTTGACAATGCTAGTCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133248.2-1678s21c1
Sequence:CCGGGCACATTATGAAGCAGAAATTCTCGAGAATTTCTGCTTCATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133248.2-783s21c1
Sequence:CCGGCCCTTTGCTGACAGCACAATTCTCGAGAATTGTGCTGTCAGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133248.1-603s1c1
Sequence:CCGGGCCTTGATAGAGTTCACGAAACTCGAGTTTCGTGAACTCTATCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133248.1-1754s1c1
Sequence:CCGGCGCTCTCTTCACATTTGACTTCTCGAGAAGTCAAATGTGAAGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133248.1-1583s1c1
Sequence:CCGGGCCACTTCATATAGGACTTAACTCGAGTTAAGTCCTATATGAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133248.1-493s1c1
Sequence:CCGGCCGTTGGACTAGCATTGTCAACTCGAGTTGACAATGCTAGTCCAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133248.1-1614s1c1
Sequence:CCGGGCACATTATGAAGCAGAAATTCTCGAGAATTTCTGCTTCATAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133248
VALIDATED
GLMN MISSION shRNA Lentiviral Transduction Particles
glomulin, FKBP associated protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133248.2-1070s21c1
Sequence:CCGGAGTTGAACATGGAGCATATTGCTCGAGCAATATGCTCCATGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133248.2-1818s21c1
Sequence:CCGGCGCTCTCTTCACATTTGACTTCTCGAGAAGTCAAATGTGAAGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133248.2-557s21c1
Sequence:CCGGCCGTTGGACTAGCATTGTCAACTCGAGTTGACAATGCTAGTCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133248.2-1678s21c1
Sequence:CCGGGCACATTATGAAGCAGAAATTCTCGAGAATTTCTGCTTCATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133248.2-783s21c1
Sequence:CCGGCCCTTTGCTGACAGCACAATTCTCGAGAATTGTGCTGTCAGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133248.1-603s1c1
Sequence:CCGGGCCTTGATAGAGTTCACGAAACTCGAGTTTCGTGAACTCTATCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133248.1-1754s1c1
Sequence:CCGGCGCTCTCTTCACATTTGACTTCTCGAGAAGTCAAATGTGAAGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133248.1-1583s1c1
Sequence:CCGGGCCACTTCATATAGGACTTAACTCGAGTTAAGTCCTATATGAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133248.1-493s1c1
Sequence:CCGGCCGTTGGACTAGCATTGTCAACTCGAGTTGACAATGCTAGTCCAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133248.1-1614s1c1
Sequence:CCGGGCACATTATGAAGCAGAAATTCTCGAGAATTTCTGCTTCATAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053274
GLMN MISSION shRNA Bacterial Glycerol Stock
glomulin, FKBP associated protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053274.2-769s21c1
Sequence:CCGGCCCTTTGCTGACAGCACAATTCTCGAGAATTGTGCTGTCAGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053274.2-1520s21c1
Sequence:CCGGGATAGGATTATGGCTTCATTACTCGAGTAATGAAGCCATAATCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053274.2-1762s21c1
Sequence:CCGGGCCTCCTGAAATGCAGCTTAACTCGAGTTAAGCTGCATTTCAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053274.2-517s21c1
Sequence:CCGGGAAACTTCATAACAAGGCATACTCGAGTATGCCTTGTTATGAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053274.2-315s21c1
Sequence:CCGGGTCCTGTTGTTCGATGCCTTTCTCGAGAAAGGCATCGAACAACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053274.1-1740s1c1
Sequence:CCGGGCCTCCTGAAATGCAGCTTAACTCGAGTTAAGCTGCATTTCAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053274.1-293s1c1
Sequence:CCGGGTCCTGTTGTTCGATGCCTTTCTCGAGAAAGGCATCGAACAACAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053274.1-1498s1c1
Sequence:CCGGGATAGGATTATGGCTTCATTACTCGAGTAATGAAGCCATAATCCTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053274.1-495s1c1
Sequence:CCGGGAAACTTCATAACAAGGCATACTCGAGTATGCCTTGTTATGAAGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053274.1-747s1c1
Sequence:CCGGCCCTTTGCTGACAGCACAATTCTCGAGAATTGTGCTGTCAGCAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053274
GLMN MISSION shRNA shRNA Plasmid DNA
glomulin, FKBP associated protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053274.2-769s21c1
Sequence:CCGGCCCTTTGCTGACAGCACAATTCTCGAGAATTGTGCTGTCAGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053274.2-1520s21c1
Sequence:CCGGGATAGGATTATGGCTTCATTACTCGAGTAATGAAGCCATAATCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053274.2-1762s21c1
Sequence:CCGGGCCTCCTGAAATGCAGCTTAACTCGAGTTAAGCTGCATTTCAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053274.2-517s21c1
Sequence:CCGGGAAACTTCATAACAAGGCATACTCGAGTATGCCTTGTTATGAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053274.2-315s21c1
Sequence:CCGGGTCCTGTTGTTCGATGCCTTTCTCGAGAAAGGCATCGAACAACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053274.1-1740s1c1
Sequence:CCGGGCCTCCTGAAATGCAGCTTAACTCGAGTTAAGCTGCATTTCAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053274.1-293s1c1
Sequence:CCGGGTCCTGTTGTTCGATGCCTTTCTCGAGAAAGGCATCGAACAACAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053274.1-1498s1c1
Sequence:CCGGGATAGGATTATGGCTTCATTACTCGAGTAATGAAGCCATAATCCTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053274.1-495s1c1
Sequence:CCGGGAAACTTCATAACAAGGCATACTCGAGTATGCCTTGTTATGAAGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053274.1-747s1c1
Sequence:CCGGCCCTTTGCTGACAGCACAATTCTCGAGAATTGTGCTGTCAGCAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053274
GLMN MISSION shRNA Lentiviral Transduction Particles
glomulin, FKBP associated protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053274.2-769s21c1
Sequence:CCGGCCCTTTGCTGACAGCACAATTCTCGAGAATTGTGCTGTCAGCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053274.2-1520s21c1
Sequence:CCGGGATAGGATTATGGCTTCATTACTCGAGTAATGAAGCCATAATCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053274.2-1762s21c1
Sequence:CCGGGCCTCCTGAAATGCAGCTTAACTCGAGTTAAGCTGCATTTCAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053274.2-517s21c1
Sequence:CCGGGAAACTTCATAACAAGGCATACTCGAGTATGCCTTGTTATGAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053274.2-315s21c1
Sequence:CCGGGTCCTGTTGTTCGATGCCTTTCTCGAGAAAGGCATCGAACAACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053274.1-1740s1c1
Sequence:CCGGGCCTCCTGAAATGCAGCTTAACTCGAGTTAAGCTGCATTTCAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053274.1-293s1c1
Sequence:CCGGGTCCTGTTGTTCGATGCCTTTCTCGAGAAAGGCATCGAACAACAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053274.1-1498s1c1
Sequence:CCGGGATAGGATTATGGCTTCATTACTCGAGTAATGAAGCCATAATCCTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053274.1-495s1c1
Sequence:CCGGGAAACTTCATAACAAGGCATACTCGAGTATGCCTTGTTATGAAGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053274.1-747s1c1
Sequence:CCGGCCCTTTGCTGACAGCACAATTCTCGAGAATTGTGCTGTCAGCAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks