EMAIL THIS PAGE TO A FRIEND

GLO1

glyoxalase I

114 Gene Product Result for
Synonyms: GLOD1 GLYI
Gene ID:
Human(2739) Summary: The enzyme encoded by this gene is responsible for the catalysis and formation of S-lactoyl-glutathione from methylglyoxal condensation and reduced glutatione. Glyoxalase I is linked to HLA and is localized to 6p21.3-p21.1, between HLA and the centromere. [provided by RefSeq, Jul 2008]
Mouse(109801) glyoxalase 1
Rat(294320) glyoxalase 1
Zebrafish(368213) glyoxalase 1
cow(540335) glyoxalase I
dog(474894) glyoxalase I
chicken(421428) glyoxalase I
sheep(101102520) glyoxalase I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK114 Glyoxalase I Activity Assay Kit sufficient for 100 tests (UV) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006708 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006708 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006708 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025374 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025374 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025374 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006708 Rosetta Predictions human pricing
NM_207594 Rosetta Predictions rat pricing
NM_001113560 Rosetta Predictions mouse pricing
NM_025374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148525 predicted 713
2 SASI_Hs01_00148526 predicted 485
3 SASI_Hs01_00148527 predicted 245
4 SASI_Hs01_00148528 predicted 503
5 SASI_Hs01_00148529 predicted 618
6 SASI_Hs02_00342132 predicted 229
7 SASI_Hs01_00148530 predicted 683
8 SASI_Hs01_00148531 predicted 490
9 SASI_Hs01_00148532 predicted 453
10 SASI_Hs01_00148533 predicted 657
11 SASI_Hs01_00148534 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094742 predicted 197
2 SASI_Rn01_00094743 predicted 269
3 SASI_Rn01_00094744 predicted 822
4 SASI_Rn01_00094745 predicted 530
5 SASI_Rn01_00094746 predicted 412
6 SASI_Rn01_00094747 predicted 302
7 SASI_Rn02_00270415 predicted 576
8 SASI_Rn01_00094748 predicted 586
9 SASI_Rn01_00094749 predicted 658
10 SASI_Rn01_00094750 predicted 624
11 SASI_Rn01_00094751 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308199 predicted 297
2 SASI_Mm02_00308200 predicted 305
3 SASI_Mm02_00308201 predicted 297
4 SASI_Mm02_00308202 predicted 227
5 SASI_Mm02_00308203 predicted 222
6 SASI_Mm02_00308204 predicted 265
7 SASI_Mm02_00308205 predicted 203
8 SASI_Mm02_00308206 predicted 197
9 SASI_Mm02_00308207 predicted 210
10 SASI_Mm02_00308208 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328092 predicted 298
2 SASI_Mm02_00328093 predicted 308
3 SASI_Mm02_00328094 predicted 298
4 SASI_Mm02_00328095 predicted 227
5 SASI_Mm02_00328096 predicted 224
6 SASI_Mm01_00078342 predicted 260
7 SASI_Mm02_00328097 predicted 206
8 SASI_Mm02_00328098 predicted 203
9 SASI_Mm02_00328099 predicted 203
10 SASI_Mm02_00328100 predicted 323
11 SASI_Mm01_00078334 predicted 658
12 SASI_Mm01_00078335 predicted 320
13 SASI_Mm01_00078336 predicted 663
14 SASI_Mm01_00078337 predicted 626
15 SASI_Mm01_00078338 predicted 568
16 SASI_Mm01_00078339 predicted 750
17 SASI_Mm01_00078340 predicted 665
18 SASI_Mm01_00078341 predicted 581
19 SASI_Mm01_00078343 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006708
VALIDATED
GLO1 MISSION shRNA Bacterial Glycerol Stock
glyoxalase I
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118627    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006708.1-1726s1c1
Sequence:CCGGCCGCCATGATTCACATTTGATCTCGAGATCAAATGTGAATCATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006708.1-292s1c1
Sequence:CCGGTCACTCTACTTCTTGGCTTATCTCGAGATAAGCCAAGAAGTAGAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006708.1-510s1c1
Sequence:CCGGGTTTGAAGAACTGGGAGTCAACTCGAGTTGACTCCCAGTTCTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006708.1-195s1c1
Sequence:CCGGGCTACGAGTGAAGGATCCTAACTCGAGTTAGGATCCTTCACTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006708.1-451s1c1
Sequence:CCGGCCTCGAGGATTCGGTCATATTCTCGAGAATATGACCGAATCCTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006708
VALIDATED
GLO1 MISSION shRNA shRNA Plasmid DNA
glyoxalase I
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118627    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006708.1-1726s1c1
Sequence:CCGGCCGCCATGATTCACATTTGATCTCGAGATCAAATGTGAATCATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006708.1-292s1c1
Sequence:CCGGTCACTCTACTTCTTGGCTTATCTCGAGATAAGCCAAGAAGTAGAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006708.1-510s1c1
Sequence:CCGGGTTTGAAGAACTGGGAGTCAACTCGAGTTGACTCCCAGTTCTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006708.1-195s1c1
Sequence:CCGGGCTACGAGTGAAGGATCCTAACTCGAGTTAGGATCCTTCACTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006708.1-451s1c1
Sequence:CCGGCCTCGAGGATTCGGTCATATTCTCGAGAATATGACCGAATCCTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006708
VALIDATED
GLO1 MISSION shRNA Lentiviral Transduction Particles
glyoxalase I
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118627    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006708.1-1726s1c1
Sequence:CCGGCCGCCATGATTCACATTTGATCTCGAGATCAAATGTGAATCATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006708.1-292s1c1
Sequence:CCGGTCACTCTACTTCTTGGCTTATCTCGAGATAAGCCAAGAAGTAGAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006708.1-510s1c1
Sequence:CCGGGTTTGAAGAACTGGGAGTCAACTCGAGTTGACTCCCAGTTCTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006708.1-195s1c1
Sequence:CCGGGCTACGAGTGAAGGATCCTAACTCGAGTTAGGATCCTTCACTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006708.1-451s1c1
Sequence:CCGGCCTCGAGGATTCGGTCATATTCTCGAGAATATGACCGAATCCTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025374
VALIDATED
GLO1 MISSION shRNA Bacterial Glycerol Stock
glyoxalase I
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025374.2-584s1c1
Sequence:CCGGGAGATTCTGAATCCTAACAAACTCGAGTTTGTTAGGATTCAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025374.2-271s1c1
Sequence:CCGGCTCGCTCTACTTCTTAGCTTACTCGAGTAAGCTAAGAAGTAGAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025374.2-397s1c1
Sequence:CCGGCGAGACTCAGAGTTACCACAACTCGAGTTGTGGTAACTCTGAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025374.2-163s1c1
Sequence:CCGGGCAGCAAACGATGCTAAGAATCTCGAGATTCTTAGCATCGTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025374.2-1033s1c1
Sequence:CCGGCCTCAGAAATAACTTTCCATACTCGAGTATGGAAAGTTATTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025374.3-204s21c1
Sequence:CCGGGCAGCAAACGATGCTAAGAATCTCGAGATTCTTAGCATCGTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025374.3-625s21c1
Sequence:CCGGGAGATTCTGAATCCTAACAAACTCGAGTTTGTTAGGATTCAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025374.3-312s21c1
Sequence:CCGGCTCGCTCTACTTCTTAGCTTACTCGAGTAAGCTAAGAAGTAGAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025374.3-473s21c1
Sequence:CCGGCTCGTGGATTTGGTCACATTGCTCGAGCAATGTGACCAAATCCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025374
VALIDATED
GLO1 MISSION shRNA shRNA Plasmid DNA
glyoxalase I
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025374.2-584s1c1
Sequence:CCGGGAGATTCTGAATCCTAACAAACTCGAGTTTGTTAGGATTCAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025374.2-271s1c1
Sequence:CCGGCTCGCTCTACTTCTTAGCTTACTCGAGTAAGCTAAGAAGTAGAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025374.2-397s1c1
Sequence:CCGGCGAGACTCAGAGTTACCACAACTCGAGTTGTGGTAACTCTGAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025374.2-163s1c1
Sequence:CCGGGCAGCAAACGATGCTAAGAATCTCGAGATTCTTAGCATCGTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025374.2-1033s1c1
Sequence:CCGGCCTCAGAAATAACTTTCCATACTCGAGTATGGAAAGTTATTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025374.3-204s21c1
Sequence:CCGGGCAGCAAACGATGCTAAGAATCTCGAGATTCTTAGCATCGTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025374.3-625s21c1
Sequence:CCGGGAGATTCTGAATCCTAACAAACTCGAGTTTGTTAGGATTCAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025374.3-312s21c1
Sequence:CCGGCTCGCTCTACTTCTTAGCTTACTCGAGTAAGCTAAGAAGTAGAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025374.3-473s21c1
Sequence:CCGGCTCGTGGATTTGGTCACATTGCTCGAGCAATGTGACCAAATCCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025374
VALIDATED
GLO1 MISSION shRNA Lentiviral Transduction Particles
glyoxalase I
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025374.2-584s1c1
Sequence:CCGGGAGATTCTGAATCCTAACAAACTCGAGTTTGTTAGGATTCAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025374.2-271s1c1
Sequence:CCGGCTCGCTCTACTTCTTAGCTTACTCGAGTAAGCTAAGAAGTAGAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025374.2-397s1c1
Sequence:CCGGCGAGACTCAGAGTTACCACAACTCGAGTTGTGGTAACTCTGAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025374.2-163s1c1
Sequence:CCGGGCAGCAAACGATGCTAAGAATCTCGAGATTCTTAGCATCGTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025374.2-1033s1c1
Sequence:CCGGCCTCAGAAATAACTTTCCATACTCGAGTATGGAAAGTTATTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025374.3-204s21c1
Sequence:CCGGGCAGCAAACGATGCTAAGAATCTCGAGATTCTTAGCATCGTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025374.3-625s21c1
Sequence:CCGGGAGATTCTGAATCCTAACAAACTCGAGTTTGTTAGGATTCAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025374.3-312s21c1
Sequence:CCGGCTCGCTCTACTTCTTAGCTTACTCGAGTAAGCTAAGAAGTAGAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025374.3-473s21c1
Sequence:CCGGCTCGTGGATTTGGTCACATTGCTCGAGCAATGTGACCAAATCCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks