EMAIL THIS PAGE TO A FRIEND

GLOD4

glyoxalase domain containing 4

57 Gene Product Result for
Synonyms: C17orf25 HC71
Gene ID:
Mouse(67201) glyoxalase domain containing 4
Rat(363644) glyoxalase domain containing 4
Zebrafish(447874) glyoxalase domain containing 4
chicken(101750166) glyoxalase domain containing 4
dog(480640) glyoxalase domain containing 4
domestic cat(101088891) glyoxalase domain containing 4
cow(512334) glyoxalase domain containing 4
domestic guinea pig(100715235) glyoxalase domain containing 4
naked mole-rat(101712091) glyoxalase domain containing 4
sheep(101113605) glyoxalase domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026029 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026029 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026029 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016080 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016080 Rosetta Predictions human pricing
NM_001014227 Rosetta Predictions rat pricing
NM_026029 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348828 predicted 1019
2 SASI_Hs01_00030919 predicted 500
3 SASI_Hs01_00030920 predicted 920
4 SASI_Hs01_00030921 predicted 290
5 SASI_Hs01_00030922 predicted 510
6 SASI_Hs01_00030923 predicted 366
7 SASI_Hs01_00030925 predicted 900
8 SASI_Hs01_00030927 predicted 413
9 SASI_Hs01_00030928 predicted 277
10 SASI_Hs02_00348829 predicted 761
11 SASI_Hs01_00030924 predicted 870
12 SASI_Hs01_00030926 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014227 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040092 predicted 425
2 SASI_Rn01_00040093 predicted 279
3 SASI_Rn01_00040094 predicted 954
4 SASI_Rn01_00040095 predicted 975
5 SASI_Rn01_00040098 predicted 267
6 SASI_Rn02_00201764 predicted 652
7 SASI_Rn01_00040099 predicted 396
8 SASI_Rn01_00040100 predicted 919
9 SASI_Rn01_00040101 predicted 848
10 SASI_Rn02_00201765 predicted 1023
11 SASI_Rn01_00040096 predicted 945
12 SASI_Rn01_00040097 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169462 predicted 906
2 SASI_Mm01_00169463 predicted 395
3 SASI_Mm01_00169464 predicted 470
4 SASI_Mm01_00169465 predicted 443
5 SASI_Mm01_00169467 predicted 535
6 SASI_Mm01_00169468 predicted 630
7 SASI_Mm01_00169469 predicted 252
8 SASI_Mm01_00169470 predicted 525
9 SASI_Mm02_00329500 predicted 648
10 SASI_Mm01_00169471 predicted 432
11 SASI_Mm01_00169466 predicted 379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026029
VALIDATED
GLOD4 MISSION shRNA Bacterial Glycerol Stock
glyoxalase domain containing 4
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.3-100s21c1
Sequence:CCGGCCGCTTCCAGACAGTGCATTTCTCGAGAAATGCACTGTCTGGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.2-140s21c1
Sequence:CCGGCTGCATGCTATGGGCCTTATGCTCGAGCATAAGGCCCATAGCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.2-531s21c1
Sequence:CCGGTTTGCTGGGCTACGCTGATAACTCGAGTTATCAGCGTAGCCCAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.2-328s21c1
Sequence:CCGGCCACTGAGTAAAGTTGCAGAACTCGAGTTCTGCAACTTTACTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026029.2-1022s21c1
Sequence:CCGGGCAGTAGTTTCACTCTTCAAACTCGAGTTTGAAGAGTGAAACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.3-183s21c1
Sequence:CCGGCTGCATGCAATGGGCCTTATGCTCGAGCATAAGGCCCATTGCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.2-870s21c1
Sequence:CCGGGTGGTTTGCTACGAGGAATAACTCGAGTTATTCCTCGTAGCAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.3-254s21c1
Sequence:CCGGTTTGTTGCAGAATTGACATACCTCGAGGTATGTCAATTCTGCAACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026029.1-1023s1c1
Sequence:CCGGGCAGTAGTTTCACTCTTCAAACTCGAGTTTGAAGAGTGAAACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026029.1-422s1c1
Sequence:CCGGCCTGTATTAAAGGTGACTCTACTCGAGTAGAGTCACCTTTAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026029.1-412s1c1
Sequence:CCGGTCAGTCAGATCCTGTATTAAACTCGAGTTTAATACAGGATCTGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026029.1-828s1c1
Sequence:CCGGGCAAATTATTGGATGATGCAACTCGAGTTGCATCATCCAATAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026029.1-329s1c1
Sequence:CCGGCCACTGAGTAAAGTTGCAGAACTCGAGTTCTGCAACTTTACTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026029
VALIDATED
GLOD4 MISSION shRNA shRNA Plasmid DNA
glyoxalase domain containing 4
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.3-100s21c1
Sequence:CCGGCCGCTTCCAGACAGTGCATTTCTCGAGAAATGCACTGTCTGGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.2-140s21c1
Sequence:CCGGCTGCATGCTATGGGCCTTATGCTCGAGCATAAGGCCCATAGCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.2-531s21c1
Sequence:CCGGTTTGCTGGGCTACGCTGATAACTCGAGTTATCAGCGTAGCCCAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.2-328s21c1
Sequence:CCGGCCACTGAGTAAAGTTGCAGAACTCGAGTTCTGCAACTTTACTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026029.2-1022s21c1
Sequence:CCGGGCAGTAGTTTCACTCTTCAAACTCGAGTTTGAAGAGTGAAACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.3-183s21c1
Sequence:CCGGCTGCATGCAATGGGCCTTATGCTCGAGCATAAGGCCCATTGCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.2-870s21c1
Sequence:CCGGGTGGTTTGCTACGAGGAATAACTCGAGTTATTCCTCGTAGCAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.3-254s21c1
Sequence:CCGGTTTGTTGCAGAATTGACATACCTCGAGGTATGTCAATTCTGCAACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026029.1-1023s1c1
Sequence:CCGGGCAGTAGTTTCACTCTTCAAACTCGAGTTTGAAGAGTGAAACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026029.1-422s1c1
Sequence:CCGGCCTGTATTAAAGGTGACTCTACTCGAGTAGAGTCACCTTTAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026029.1-412s1c1
Sequence:CCGGTCAGTCAGATCCTGTATTAAACTCGAGTTTAATACAGGATCTGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026029.1-828s1c1
Sequence:CCGGGCAAATTATTGGATGATGCAACTCGAGTTGCATCATCCAATAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026029.1-329s1c1
Sequence:CCGGCCACTGAGTAAAGTTGCAGAACTCGAGTTCTGCAACTTTACTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026029
VALIDATED
GLOD4 MISSION shRNA Lentiviral Transduction Particles
glyoxalase domain containing 4
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.3-100s21c1
Sequence:CCGGCCGCTTCCAGACAGTGCATTTCTCGAGAAATGCACTGTCTGGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.2-140s21c1
Sequence:CCGGCTGCATGCTATGGGCCTTATGCTCGAGCATAAGGCCCATAGCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.2-531s21c1
Sequence:CCGGTTTGCTGGGCTACGCTGATAACTCGAGTTATCAGCGTAGCCCAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.2-328s21c1
Sequence:CCGGCCACTGAGTAAAGTTGCAGAACTCGAGTTCTGCAACTTTACTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026029.2-1022s21c1
Sequence:CCGGGCAGTAGTTTCACTCTTCAAACTCGAGTTTGAAGAGTGAAACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.3-183s21c1
Sequence:CCGGCTGCATGCAATGGGCCTTATGCTCGAGCATAAGGCCCATTGCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.2-870s21c1
Sequence:CCGGGTGGTTTGCTACGAGGAATAACTCGAGTTATTCCTCGTAGCAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026029.3-254s21c1
Sequence:CCGGTTTGTTGCAGAATTGACATACCTCGAGGTATGTCAATTCTGCAACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026029.1-1023s1c1
Sequence:CCGGGCAGTAGTTTCACTCTTCAAACTCGAGTTTGAAGAGTGAAACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026029.1-422s1c1
Sequence:CCGGCCTGTATTAAAGGTGACTCTACTCGAGTAGAGTCACCTTTAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026029.1-412s1c1
Sequence:CCGGTCAGTCAGATCCTGTATTAAACTCGAGTTTAATACAGGATCTGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026029.1-828s1c1
Sequence:CCGGGCAAATTATTGGATGATGCAACTCGAGTTGCATCATCCAATAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026029.1-329s1c1
Sequence:CCGGCCACTGAGTAAAGTTGCAGAACTCGAGTTCTGCAACTTTACTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016080
VALIDATED
GLOD4 MISSION shRNA Bacterial Glycerol Stock
glyoxalase domain containing 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016080.3-848s21c1
Sequence:CCGGGATGAAGCATTTCGAGAACTTCTCGAGAAGTTCTCGAAATGCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281184    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016080.3-1639s21c1
Sequence:CCGGCGACAGAACATCATGTGAGATCTCGAGATCTCACATGATGTTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016080.3-932s21c1
Sequence:CCGGGAGTGGTTTGCCAAACACAATCTCGAGATTGTGTTTGGCAAACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016080.3-324s21c1
Sequence:CCGGGCAATGACTTTATGGGAATCACTCGAGTGATTCCCATAAAGTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016080.2-1615s1c1
Sequence:CCGGCGACAGAACATCATGTGAGATCTCGAGATCTCACATGATGTTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016080.2-300s1c1
Sequence:CCGGGCAATGACTTTATGGGAATCACTCGAGTGATTCCCATAAAGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016080.2-824s1c1
Sequence:CCGGGATGAAGCATTTCGAGAACTTCTCGAGAAGTTCTCGAAATGCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016080.2-908s1c1
Sequence:CCGGGAGTGGTTTGCCAAACACAATCTCGAGATTGTGTTTGGCAAACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183102    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016080.2-1557s1c1
Sequence:CCGGCGAGCTTCTTTCTGTGTATATCTCGAGATATACACAGAAAGAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179893    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016080.2-1472s1c1
Sequence:CCGGCCCTCTTACTTGCTTTCACATCTCGAGATGTGAAAGCAAGTAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016080
VALIDATED
GLOD4 MISSION shRNA shRNA Plasmid DNA
glyoxalase domain containing 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016080.3-848s21c1
Sequence:CCGGGATGAAGCATTTCGAGAACTTCTCGAGAAGTTCTCGAAATGCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281184    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016080.3-1639s21c1
Sequence:CCGGCGACAGAACATCATGTGAGATCTCGAGATCTCACATGATGTTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016080.3-932s21c1
Sequence:CCGGGAGTGGTTTGCCAAACACAATCTCGAGATTGTGTTTGGCAAACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016080.3-324s21c1
Sequence:CCGGGCAATGACTTTATGGGAATCACTCGAGTGATTCCCATAAAGTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016080.2-1615s1c1
Sequence:CCGGCGACAGAACATCATGTGAGATCTCGAGATCTCACATGATGTTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016080.2-300s1c1
Sequence:CCGGGCAATGACTTTATGGGAATCACTCGAGTGATTCCCATAAAGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016080.2-824s1c1
Sequence:CCGGGATGAAGCATTTCGAGAACTTCTCGAGAAGTTCTCGAAATGCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016080.2-908s1c1
Sequence:CCGGGAGTGGTTTGCCAAACACAATCTCGAGATTGTGTTTGGCAAACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183102    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016080.2-1557s1c1
Sequence:CCGGCGAGCTTCTTTCTGTGTATATCTCGAGATATACACAGAAAGAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179893    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016080.2-1472s1c1
Sequence:CCGGCCCTCTTACTTGCTTTCACATCTCGAGATGTGAAAGCAAGTAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016080
VALIDATED
GLOD4 MISSION shRNA Lentiviral Transduction Particles
glyoxalase domain containing 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016080.3-848s21c1
Sequence:CCGGGATGAAGCATTTCGAGAACTTCTCGAGAAGTTCTCGAAATGCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281184    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016080.3-1639s21c1
Sequence:CCGGCGACAGAACATCATGTGAGATCTCGAGATCTCACATGATGTTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016080.3-932s21c1
Sequence:CCGGGAGTGGTTTGCCAAACACAATCTCGAGATTGTGTTTGGCAAACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016080.3-324s21c1
Sequence:CCGGGCAATGACTTTATGGGAATCACTCGAGTGATTCCCATAAAGTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016080.2-1615s1c1
Sequence:CCGGCGACAGAACATCATGTGAGATCTCGAGATCTCACATGATGTTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016080.2-300s1c1
Sequence:CCGGGCAATGACTTTATGGGAATCACTCGAGTGATTCCCATAAAGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016080.2-824s1c1
Sequence:CCGGGATGAAGCATTTCGAGAACTTCTCGAGAAGTTCTCGAAATGCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016080.2-908s1c1
Sequence:CCGGGAGTGGTTTGCCAAACACAATCTCGAGATTGTGTTTGGCAAACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183102    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016080.2-1557s1c1
Sequence:CCGGCGAGCTTCTTTCTGTGTATATCTCGAGATATACACAGAAAGAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179893    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016080.2-1472s1c1
Sequence:CCGGCCCTCTTACTTGCTTTCACATCTCGAGATGTGAAAGCAAGTAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks