EMAIL THIS PAGE TO A FRIEND

GLOD5

glyoxalase domain containing 5

53 Gene Product Result for
UniProtKB ID: A6NK44
Gene ID:
Human(392465) Summary: This gene encodes a protein with a glyoxalase domain. [provided by RefSeq, Sep 2011]
Mouse(69824) glyoxalase domain containing 5
Rat(302554) glyoxalase domain containing 5
sheep(101114085) glyoxalase domain containing 5
domestic guinea pig(100717427) glyoxalase domain containing 5
naked mole-rat(101703614) glyoxalase domain containing 5
chicken(771737) glyoxalase domain containing 5
cow(100296486) glyoxalase domain containing 5
domestic cat(101095957) glyoxalase domain containing 5
dog(480905) glyoxalase domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027227 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027227 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027227 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080489 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU032321 MISSION® esiRNA esiRNA targeting mouse Glod5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080489 Rosetta Predictions human pricing
XM_373347 Rosetta Predictions human pricing
NM_001106957 Rosetta Predictions rat pricing
NM_027227 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315335 predicted 230
2 SASI_Hs02_00315336 predicted 230
3 SASI_Hs02_00315337 predicted 234
4 SASI_Hs02_00315338 predicted 236
5 SASI_Hs02_00315339 predicted 225
6 SASI_Hs02_00315340 predicted 232
7 SASI_Hs02_00315341 predicted 232
8 SASI_Hs02_00315342 predicted 240
9 SASI_Hs02_00315343 predicted 242
10 SASI_Hs02_00315344 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_373347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285862 predicted 345
2 SASI_Hs01_00285863 predicted 291
3 SASI_Hs01_00285864 predicted 400
4 SASI_Hs01_00285865 predicted 344
5 SASI_Hs01_00285866 predicted 445
6 SASI_Hs01_00285867 predicted 315
7 SASI_Hs01_00285868 predicted 284
8 SASI_Hs01_00285869 predicted 246
9 SASI_Hs01_00285870 predicted 397
10 SASI_Hs01_00285871 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224076 predicted 314
2 SASI_Rn02_00224077 predicted 191
3 SASI_Rn02_00224078 predicted 474
4 SASI_Rn02_00224079 predicted 270
5 SASI_Rn02_00224080 predicted 435
6 SASI_Rn02_00224081 predicted 199
7 SASI_Rn02_00224082 predicted 316
8 SASI_Rn02_00224083 predicted 317
9 SASI_Rn02_00224084 predicted 317
10 SASI_Rn02_00224085 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027227 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141859 predicted 312
2 SASI_Mm01_00141860 predicted 421
3 SASI_Mm01_00141861 predicted 384
4 SASI_Mm01_00141862 predicted 391
5 SASI_Mm01_00141864 predicted 304
6 SASI_Mm01_00141865 predicted 215
7 SASI_Mm02_00331791 predicted 392
8 SASI_Mm01_00141866 predicted 248
9 SASI_Mm01_00141867 predicted 443
10 SASI_Mm02_00331792 predicted 437
11 SASI_Mm01_00141863 predicted 207
12 SASI_Mm01_00141868 predicted 320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027227
GLOD5 MISSION shRNA Bacterial Glycerol Stock
glyoxalase domain containing 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027227.1-230s1c1
Sequence:CCGGGCATTGTGTTTCGGAGACCAACTCGAGTTGGTCTCCGAAACACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027227.1-462s1c1
Sequence:CCGGGAAATCTCCTTGAGGTGTCCACTCGAGTGGACACCTCAAGGAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027227.1-196s1c1
Sequence:CCGGCATGGAGGTCACTACTTTCAACTCGAGTTGAAAGTAGTGACCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027227.1-110s1c1
Sequence:CCGGCCGTGTCTTATCTGTAGACTTCTCGAGAAGTCTACAGATAAGACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027227.1-219s1c1
Sequence:CCGGGAAACCGGAAAGCATTGTGTTCTCGAGAACACAATGCTTTCCGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027227.1-427s1c1
Sequence:CCGGGCCTATTCTATCCATCTACTTCTCGAGAAGTAGATGGATAGAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027227.1-133s1c1
Sequence:CCGGCCACATTGTGATGACTGTAAACTCGAGTTTACAGTCATCACAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027227.2-193s21c1
Sequence:CCGGCATGGAGGTCACTACTTTCAACTCGAGTTGAAAGTAGTGACCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027227.2-216s21c1
Sequence:CCGGGAAACCGGAAAGCATTGTGTTCTCGAGAACACAATGCTTTCCGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027227.2-424s21c1
Sequence:CCGGGCCTATTCTATCCATCTACTTCTCGAGAAGTAGATGGATAGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027227
GLOD5 MISSION shRNA shRNA Plasmid DNA
glyoxalase domain containing 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027227.1-230s1c1
Sequence:CCGGGCATTGTGTTTCGGAGACCAACTCGAGTTGGTCTCCGAAACACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027227.1-462s1c1
Sequence:CCGGGAAATCTCCTTGAGGTGTCCACTCGAGTGGACACCTCAAGGAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027227.1-196s1c1
Sequence:CCGGCATGGAGGTCACTACTTTCAACTCGAGTTGAAAGTAGTGACCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027227.1-110s1c1
Sequence:CCGGCCGTGTCTTATCTGTAGACTTCTCGAGAAGTCTACAGATAAGACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027227.1-219s1c1
Sequence:CCGGGAAACCGGAAAGCATTGTGTTCTCGAGAACACAATGCTTTCCGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027227.1-427s1c1
Sequence:CCGGGCCTATTCTATCCATCTACTTCTCGAGAAGTAGATGGATAGAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027227.1-133s1c1
Sequence:CCGGCCACATTGTGATGACTGTAAACTCGAGTTTACAGTCATCACAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027227.2-193s21c1
Sequence:CCGGCATGGAGGTCACTACTTTCAACTCGAGTTGAAAGTAGTGACCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027227.2-216s21c1
Sequence:CCGGGAAACCGGAAAGCATTGTGTTCTCGAGAACACAATGCTTTCCGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027227.2-424s21c1
Sequence:CCGGGCCTATTCTATCCATCTACTTCTCGAGAAGTAGATGGATAGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027227
GLOD5 MISSION shRNA Lentiviral Transduction Particles
glyoxalase domain containing 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027227.1-230s1c1
Sequence:CCGGGCATTGTGTTTCGGAGACCAACTCGAGTTGGTCTCCGAAACACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027227.1-462s1c1
Sequence:CCGGGAAATCTCCTTGAGGTGTCCACTCGAGTGGACACCTCAAGGAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027227.1-196s1c1
Sequence:CCGGCATGGAGGTCACTACTTTCAACTCGAGTTGAAAGTAGTGACCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027227.1-110s1c1
Sequence:CCGGCCGTGTCTTATCTGTAGACTTCTCGAGAAGTCTACAGATAAGACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027227.1-219s1c1
Sequence:CCGGGAAACCGGAAAGCATTGTGTTCTCGAGAACACAATGCTTTCCGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027227.1-427s1c1
Sequence:CCGGGCCTATTCTATCCATCTACTTCTCGAGAAGTAGATGGATAGAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027227.1-133s1c1
Sequence:CCGGCCACATTGTGATGACTGTAAACTCGAGTTTACAGTCATCACAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027227.2-193s21c1
Sequence:CCGGCATGGAGGTCACTACTTTCAACTCGAGTTGAAAGTAGTGACCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027227.2-216s21c1
Sequence:CCGGGAAACCGGAAAGCATTGTGTTCTCGAGAACACAATGCTTTCCGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027227.2-424s21c1
Sequence:CCGGGCCTATTCTATCCATCTACTTCTCGAGAAGTAGATGGATAGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080489
GLOD5 MISSION shRNA Bacterial Glycerol Stock
glyoxalase domain containing 5
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000245715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080489.1-85s21c1
Sequence:CCGGCCATGTCTTATCCGTAGACTTCTCGAGAAGTCTACGGATAAGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080489.1-110s21c1
Sequence:CCGGACATCGTGATGACGGTGAAGACTCGAGTCTTCACCGTCATCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080489.1-281s21c1
Sequence:CCGGTTCCTGGCTCCCTGGACATATCTCGAGATATGTCCAGGGAGCCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080489.1-167s21c1
Sequence:CCGGTGGGCATGGAGGTCATGACTTCTCGAGAAGTCATGACCTCCATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080489
GLOD5 MISSION shRNA shRNA Plasmid DNA
glyoxalase domain containing 5
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000245715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080489.1-85s21c1
Sequence:CCGGCCATGTCTTATCCGTAGACTTCTCGAGAAGTCTACGGATAAGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080489.1-110s21c1
Sequence:CCGGACATCGTGATGACGGTGAAGACTCGAGTCTTCACCGTCATCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080489.1-281s21c1
Sequence:CCGGTTCCTGGCTCCCTGGACATATCTCGAGATATGTCCAGGGAGCCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080489.1-167s21c1
Sequence:CCGGTGGGCATGGAGGTCATGACTTCTCGAGAAGTCATGACCTCCATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080489
GLOD5 MISSION shRNA Lentiviral Transduction Particles
glyoxalase domain containing 5
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000245715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080489.1-85s21c1
Sequence:CCGGCCATGTCTTATCCGTAGACTTCTCGAGAAGTCTACGGATAAGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080489.1-110s21c1
Sequence:CCGGACATCGTGATGACGGTGAAGACTCGAGTCTTCACCGTCATCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080489.1-281s21c1
Sequence:CCGGTTCCTGGCTCCCTGGACATATCTCGAGATATGTCCAGGGAGCCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080489.1-167s21c1
Sequence:CCGGTGGGCATGGAGGTCATGACTTCTCGAGAAGTCATGACCTCCATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks