EMAIL THIS PAGE TO A FRIEND

GLP1R

glucagon-like peptide 1 receptor

189 Gene Product Result for
UniProtKB ID: P43220, Q2M229, Q99669
Gene ID:
Mouse(14652) glucagon-like peptide 1 receptor
Rat(25051) glucagon-like peptide 1 receptor
chicken(428573) glucagon-like peptide 1 receptor
dog(481778) glucagon-like peptide 1 receptor
domestic cat(101095495) glucagon-like peptide 1 receptor
cow(517420) glucagon-like peptide 1 receptor
domestic guinea pig(100727047) glucagon-like peptide 1 receptor
naked mole-rat(101698726) glucagon-like peptide 1 receptor
sheep(541609) glucagon-like peptide 1 receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
E7269 Exendin Fragment 9-39 ≥95% (HPLC) human pricing
E7019 Exendin-3 ≥97% human pricing
E7144 Exendin-4 ≥97% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002062 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002062 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002062 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021332 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021332 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021332 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU086381 MISSION® esiRNA esiRNA targeting mouse Glp1r (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002062 Rosetta Predictions human pricing
NM_012728 Rosetta Predictions rat pricing
XM_001079032 Rosetta Predictions rat pricing
XM_579346 Rosetta Predictions rat pricing
NM_021332 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333114 predicted 345
2 SASI_Hs02_00333115 predicted 590
3 SASI_Hs02_00333116 predicted 624
4 SASI_Hs02_00333117 predicted 801
5 SASI_Hs02_00333118 predicted 1319
6 SASI_Hs01_00138665 predicted 534
7 SASI_Hs02_00333119 predicted 517
8 SASI_Hs01_00138666 predicted 614
9 SASI_Hs02_00333120 predicted 234
10 SASI_Hs01_00138667 predicted 960
11 SASI_Hs01_00138664 predicted 568
12 SASI_Hs01_00138668 predicted 568
13 SASI_Hs01_00138669 predicted 792
14 SASI_Hs01_00138670 predicted 1896
15 SASI_Hs01_00138671 predicted 704
16 SASI_Hs01_00138672 predicted 713
17 SASI_Hs01_00138673 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012728 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102001 predicted 755
2 SASI_Rn01_00102002 predicted 1148
3 SASI_Rn02_00260073 predicted 244
4 SASI_Rn01_00102003 predicted 779
5 SASI_Rn01_00102005 predicted 695
6 SASI_Rn01_00102006 predicted 1279
7 SASI_Rn01_00102007 predicted 1243
8 SASI_Rn01_00102008 predicted 1192
9 SASI_Rn01_00102009 predicted 1818
10 SASI_Rn01_00102010 predicted 1785
11 SASI_Rn01_00102004 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362937 predicted 735
2 SASI_Rn02_00362938 predicted 319
3 SASI_Rn02_00362939 predicted 765
4 SASI_Rn02_00362940 predicted 678
5 SASI_Rn02_00362941 predicted 819
6 SASI_Rn02_00362942 predicted 605
7 SASI_Rn02_00362943 predicted 536
8 SASI_Rn02_00362944 predicted 505
9 SASI_Rn02_00362945 predicted 848
10 SASI_Rn02_00362946 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00132746 predicted 613
2 SASI_Rn01_00132747 predicted 588
3 SASI_Rn01_00132748 predicted 611
4 SASI_Rn01_00132749 predicted 557
5 SASI_Rn01_00132750 predicted 589
6 SASI_Rn01_00132751 predicted 530
7 SASI_Rn01_00132752 predicted 552
8 SASI_Rn01_00132753 predicted 502
9 SASI_Rn01_00132754 predicted 485
10 SASI_Rn01_00132755 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021332 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120676 predicted 899
2 SASI_Mm01_00120677 predicted 1148
3 SASI_Mm01_00120678 predicted 858
4 SASI_Mm01_00120679 predicted 1100
5 SASI_Mm01_00120680 predicted 399
6 SASI_Mm01_00120681 predicted 496
7 SASI_Mm01_00120682 predicted 1190
8 SASI_Mm01_00120683 predicted 300
9 SASI_Mm01_00120684 predicted 1018
10 SASI_Mm01_00120685 predicted 983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002062
GLP1R MISSION shRNA Bacterial Glycerol Stock
glucagon-like peptide 1 receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002062.3-1809s21c1
Sequence:CCGGCTCAAGGTCAACGGCTTATTACTCGAGTAATAAGCCGTTGACCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002062.3-246s21c1
Sequence:CCGGCAACCGGACCTTCGATGAATACTCGAGTATTCATCGAAGGTCCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002062.3-1196s21c1
Sequence:CCGGTGCGCTTCATCAAGCTGTTTACTCGAGTAAACAGCTTGATGAAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002062.3-821s21c1
Sequence:CCGGTGCTGGCCTTCTCGGTCTTATCTCGAGATAAGACCGAGAAGGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002062.2-2617s1c1
Sequence:CCGGCCACTCACACTTGGAGCTAATCTCGAGATTAGCTCCAAGTGTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002062.2-1135s1c1
Sequence:CCGGCTGCGCTTCATCAAGCTGTTTCTCGAGAAACAGCTTGATGAAGCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002062.2-540s1c1
Sequence:CCGGCCTGAACCTGTTTGCATCCTTCTCGAGAAGGATGCAAACAGGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002062.2-104s1c1
Sequence:CCGGCGGTGCAGAAATGGCGAGAATCTCGAGATTCTCGCCATTTCTGCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002062.2-963s1c1
Sequence:CCGGCCTCATCTTTGTTCGGGTCATCTCGAGATGACCCGAACAAAGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002062
GLP1R MISSION shRNA shRNA Plasmid DNA
glucagon-like peptide 1 receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002062.3-1809s21c1
Sequence:CCGGCTCAAGGTCAACGGCTTATTACTCGAGTAATAAGCCGTTGACCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002062.3-246s21c1
Sequence:CCGGCAACCGGACCTTCGATGAATACTCGAGTATTCATCGAAGGTCCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002062.3-1196s21c1
Sequence:CCGGTGCGCTTCATCAAGCTGTTTACTCGAGTAAACAGCTTGATGAAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002062.3-821s21c1
Sequence:CCGGTGCTGGCCTTCTCGGTCTTATCTCGAGATAAGACCGAGAAGGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002062.2-2617s1c1
Sequence:CCGGCCACTCACACTTGGAGCTAATCTCGAGATTAGCTCCAAGTGTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002062.2-1135s1c1
Sequence:CCGGCTGCGCTTCATCAAGCTGTTTCTCGAGAAACAGCTTGATGAAGCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002062.2-540s1c1
Sequence:CCGGCCTGAACCTGTTTGCATCCTTCTCGAGAAGGATGCAAACAGGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002062.2-104s1c1
Sequence:CCGGCGGTGCAGAAATGGCGAGAATCTCGAGATTCTCGCCATTTCTGCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002062.2-963s1c1
Sequence:CCGGCCTCATCTTTGTTCGGGTCATCTCGAGATGACCCGAACAAAGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002062
GLP1R MISSION shRNA Lentiviral Transduction Particles
glucagon-like peptide 1 receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002062.3-1809s21c1
Sequence:CCGGCTCAAGGTCAACGGCTTATTACTCGAGTAATAAGCCGTTGACCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002062.3-246s21c1
Sequence:CCGGCAACCGGACCTTCGATGAATACTCGAGTATTCATCGAAGGTCCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002062.3-1196s21c1
Sequence:CCGGTGCGCTTCATCAAGCTGTTTACTCGAGTAAACAGCTTGATGAAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002062.3-821s21c1
Sequence:CCGGTGCTGGCCTTCTCGGTCTTATCTCGAGATAAGACCGAGAAGGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002062.2-2617s1c1
Sequence:CCGGCCACTCACACTTGGAGCTAATCTCGAGATTAGCTCCAAGTGTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002062.2-1135s1c1
Sequence:CCGGCTGCGCTTCATCAAGCTGTTTCTCGAGAAACAGCTTGATGAAGCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002062.2-540s1c1
Sequence:CCGGCCTGAACCTGTTTGCATCCTTCTCGAGAAGGATGCAAACAGGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002062.2-104s1c1
Sequence:CCGGCGGTGCAGAAATGGCGAGAATCTCGAGATTCTCGCCATTTCTGCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002062.2-963s1c1
Sequence:CCGGCCTCATCTTTGTTCGGGTCATCTCGAGATGACCCGAACAAAGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021332
GLP1R MISSION shRNA Bacterial Glycerol Stock
glucagon-like peptide 1 receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021332.1-887s1c1
Sequence:CCGGGCTGGACTAGGAACTCCAATACTCGAGTATTGGAGTTCCTAGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021332.1-397s1c1
Sequence:CCGGGAGAGAAACTTTCCTGAGGAACTCGAGTTCCTCAGGAAAGTTTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021332.1-652s1c1
Sequence:CCGGCTCTCCTATCAGGACTCTCTACTCGAGTAGAGAGTCCTGATAGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021332.1-951s1c1
Sequence:CCGGCGGCGTCAACTTTCTTATCTTCTCGAGAAGATAAGAAAGTTGACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021332.1-1134s1c1
Sequence:CCGGCCTACGCTTCATCAAGCTGTTCTCGAGAACAGCTTGATGAAGCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021332
GLP1R MISSION shRNA shRNA Plasmid DNA
glucagon-like peptide 1 receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021332.1-887s1c1
Sequence:CCGGGCTGGACTAGGAACTCCAATACTCGAGTATTGGAGTTCCTAGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021332.1-397s1c1
Sequence:CCGGGAGAGAAACTTTCCTGAGGAACTCGAGTTCCTCAGGAAAGTTTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021332.1-652s1c1
Sequence:CCGGCTCTCCTATCAGGACTCTCTACTCGAGTAGAGAGTCCTGATAGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021332.1-951s1c1
Sequence:CCGGCGGCGTCAACTTTCTTATCTTCTCGAGAAGATAAGAAAGTTGACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021332.1-1134s1c1
Sequence:CCGGCCTACGCTTCATCAAGCTGTTCTCGAGAACAGCTTGATGAAGCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021332
GLP1R MISSION shRNA Lentiviral Transduction Particles
glucagon-like peptide 1 receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021332.1-887s1c1
Sequence:CCGGGCTGGACTAGGAACTCCAATACTCGAGTATTGGAGTTCCTAGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021332.1-397s1c1
Sequence:CCGGGAGAGAAACTTTCCTGAGGAACTCGAGTTCCTCAGGAAAGTTTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021332.1-652s1c1
Sequence:CCGGCTCTCCTATCAGGACTCTCTACTCGAGTAGAGAGTCCTGATAGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021332.1-951s1c1
Sequence:CCGGCGGCGTCAACTTTCTTATCTTCTCGAGAAGATAAGAAAGTTGACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021332.1-1134s1c1
Sequence:CCGGCCTACGCTTCATCAAGCTGTTCTCGAGAACAGCTTGATGAAGCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks