EMAIL THIS PAGE TO A FRIEND

GLP2R

glucagon-like peptide 2 receptor

55 Gene Product Result for
UniProtKB ID: O95838, Q4VAT3
Gene ID:
Human(9340) Summary: The GLP2 receptor (GLP2R) is a G protein-coupled receptor superfamily member closely related to the glucagon receptor ans GLP1 receptor. Glucagon-like peptide-2 (GLP2) is a 33-amino acid proglucagon-derived peptide produced by intestinal enteroendocrine cells. Like glucagon-like peptide-1 (GLP1) and glucagon itself, it is derived from the proglucagon peptide encoded by the GCG gene. GLP2 stimulates intestinal growth and upregulates villus height in the small intestine, concomitant with increased crypt cell proliferation and decreased enterocyte apoptosis. Moreover, GLP2 prevents intestinal hypoplasia resulting from total parenteral nutrition. GLP2R, a G protein-coupled receptor superfamily member is expressed in the gut and closely related to the glucagon receptor (GCGR) and the receptor for GLP1 (GLP1R). [provided by RefSeq, Jul 2008]
Mouse(93896) glucagon-like peptide 2 receptor
Rat(60432) glucagon-like peptide 2 receptor
sheep(100174983) glucagon-like peptide 2 receptor
Domestic Rabbit(100338519) glucagon-like peptide 2 receptor
domestic guinea pig(100735903) glucagon-like peptide 2 receptor
naked mole-rat(101725589) glucagon-like peptide 2 receptor
chicken(427787) glucagon-like peptide 2 receptor
dog(489499) glucagon-like peptide 2 receptor
domestic cat(101083631) glucagon-like peptide 2 receptor
cow(511942) glucagon-like peptide 2 receptor
Horse(100073078) glucagon-like peptide 2 receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004246 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175681 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175681 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175681 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004246 Rosetta Predictions human pricing
NM_021848 Rosetta Predictions rat pricing
NM_175681 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065654 predicted 503
2 SASI_Hs01_00065655 predicted 549
3 SASI_Hs01_00065657 predicted 441
4 SASI_Hs01_00065659 predicted 1333
5 SASI_Hs01_00065660 predicted 1043
6 SASI_Hs01_00065661 predicted 1219
7 SASI_Hs01_00065663 predicted 429
8 SASI_Hs02_00337180 predicted 319
9 SASI_Hs02_00337181 predicted 546
10 SASI_Hs02_00337182 predicted 252
11 SASI_Hs01_00065656 predicted 1124
12 SASI_Hs01_00065658 predicted 994
13 SASI_Hs01_00065662 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021848 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110168 predicted 577
2 SASI_Rn01_00110169 predicted 842
3 SASI_Rn01_00110170 predicted 632
4 SASI_Rn01_00110171 predicted 445
5 SASI_Rn01_00110173 predicted 460
6 SASI_Rn02_00262871 predicted 218
7 SASI_Rn01_00110174 predicted 435
8 SASI_Rn01_00110175 predicted 255
9 SASI_Rn01_00110176 predicted 1240
10 SASI_Rn01_00110177 predicted 499
11 SASI_Rn01_00110172 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101786 predicted 753
2 SASI_Mm01_00101787 predicted 801
3 SASI_Mm01_00101788 predicted 634
4 SASI_Mm01_00101789 predicted 670
5 SASI_Mm01_00101790 predicted 1003
6 SASI_Mm01_00101791 predicted 1160
7 SASI_Mm01_00101793 predicted 1296
8 SASI_Mm01_00101794 predicted 679
9 SASI_Mm01_00101795 predicted 334
10 SASI_Mm02_00346614 predicted 1203
11 SASI_Mm01_00101792 predicted 918
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004246
GLP2R MISSION shRNA Bacterial Glycerol Stock
glucagon-like peptide 2 receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004246.1-789s1c1
Sequence:CCGGCCAGGTTCTCTTGCATTACTTCTCGAGAAGTAATGCAAGAGAACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004246.1-318s1c1
Sequence:CCGGGCCTCATTCTTCTCCTGGAAACTCGAGTTTCCAGGAGAAGAATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004246.1-696s1c1
Sequence:CCGGCGTCGTCTTCTACAACTCTTACTCGAGTAAGAGTTGTAGAAGACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004246.1-350s1c1
Sequence:CCGGCCTGCCCTTCATACTTACCTTCTCGAGAAGGTAAGTATGAAGGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004246.1-1044s1c1
Sequence:CCGGGCTCTGTGTAACAGTCAATTTCTCGAGAAATTGACTGTTACACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004246.1-791s21c1
Sequence:CCGGAGGTTCTCTTGCATTACTTTGCTCGAGCAAAGTAATGCAAGAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004246.1-1045s21c1
Sequence:CCGGCTCTGTGTAACAGTCAATTTCCTCGAGGAAATTGACTGTTACACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004246.1-437s21c1
Sequence:CCGGTAGAGAACGCCACGGATATTTCTCGAGAAATATCCGTGGCGTTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004246
GLP2R MISSION shRNA shRNA Plasmid DNA
glucagon-like peptide 2 receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004246.1-789s1c1
Sequence:CCGGCCAGGTTCTCTTGCATTACTTCTCGAGAAGTAATGCAAGAGAACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004246.1-318s1c1
Sequence:CCGGGCCTCATTCTTCTCCTGGAAACTCGAGTTTCCAGGAGAAGAATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004246.1-696s1c1
Sequence:CCGGCGTCGTCTTCTACAACTCTTACTCGAGTAAGAGTTGTAGAAGACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004246.1-350s1c1
Sequence:CCGGCCTGCCCTTCATACTTACCTTCTCGAGAAGGTAAGTATGAAGGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004246.1-1044s1c1
Sequence:CCGGGCTCTGTGTAACAGTCAATTTCTCGAGAAATTGACTGTTACACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004246.1-791s21c1
Sequence:CCGGAGGTTCTCTTGCATTACTTTGCTCGAGCAAAGTAATGCAAGAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004246.1-1045s21c1
Sequence:CCGGCTCTGTGTAACAGTCAATTTCCTCGAGGAAATTGACTGTTACACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004246.1-437s21c1
Sequence:CCGGTAGAGAACGCCACGGATATTTCTCGAGAAATATCCGTGGCGTTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004246
GLP2R MISSION shRNA Lentiviral Transduction Particles
glucagon-like peptide 2 receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004246.1-789s1c1
Sequence:CCGGCCAGGTTCTCTTGCATTACTTCTCGAGAAGTAATGCAAGAGAACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004246.1-318s1c1
Sequence:CCGGGCCTCATTCTTCTCCTGGAAACTCGAGTTTCCAGGAGAAGAATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004246.1-696s1c1
Sequence:CCGGCGTCGTCTTCTACAACTCTTACTCGAGTAAGAGTTGTAGAAGACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004246.1-350s1c1
Sequence:CCGGCCTGCCCTTCATACTTACCTTCTCGAGAAGGTAAGTATGAAGGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004246.1-1044s1c1
Sequence:CCGGGCTCTGTGTAACAGTCAATTTCTCGAGAAATTGACTGTTACACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004246.1-791s21c1
Sequence:CCGGAGGTTCTCTTGCATTACTTTGCTCGAGCAAAGTAATGCAAGAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004246.1-1045s21c1
Sequence:CCGGCTCTGTGTAACAGTCAATTTCCTCGAGGAAATTGACTGTTACACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004246.1-437s21c1
Sequence:CCGGTAGAGAACGCCACGGATATTTCTCGAGAAATATCCGTGGCGTTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175681
GLP2R MISSION shRNA Bacterial Glycerol Stock
glucagon-like peptide 2 receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175681.2-1103s1c1
Sequence:CCGGGCTGTTTGTTATTCCCTGGATCTCGAGATCCAGGGAATAACAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175681.2-4613s1c1
Sequence:CCGGCCTCTGATAATCTCAATGATACTCGAGTATCATTGAGATTATCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175681.2-425s1c1
Sequence:CCGGCGAGAAACCTTCTGGTGTATTCTCGAGAATACACCAGAAGGTTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175681.2-511s1c1
Sequence:CCGGCCTGTCCTTCATACTTACCTTCTCGAGAAGGTAAGTATGAAGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175681.2-1779s1c1
Sequence:CCGGGCCAATACCATGGAGGAGATTCTCGAGAATCTCCTCCATGGTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175681
GLP2R MISSION shRNA shRNA Plasmid DNA
glucagon-like peptide 2 receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175681.2-1103s1c1
Sequence:CCGGGCTGTTTGTTATTCCCTGGATCTCGAGATCCAGGGAATAACAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175681.2-4613s1c1
Sequence:CCGGCCTCTGATAATCTCAATGATACTCGAGTATCATTGAGATTATCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175681.2-425s1c1
Sequence:CCGGCGAGAAACCTTCTGGTGTATTCTCGAGAATACACCAGAAGGTTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175681.2-511s1c1
Sequence:CCGGCCTGTCCTTCATACTTACCTTCTCGAGAAGGTAAGTATGAAGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175681.2-1779s1c1
Sequence:CCGGGCCAATACCATGGAGGAGATTCTCGAGAATCTCCTCCATGGTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175681
GLP2R MISSION shRNA Lentiviral Transduction Particles
glucagon-like peptide 2 receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175681.2-1103s1c1
Sequence:CCGGGCTGTTTGTTATTCCCTGGATCTCGAGATCCAGGGAATAACAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175681.2-4613s1c1
Sequence:CCGGCCTCTGATAATCTCAATGATACTCGAGTATCATTGAGATTATCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175681.2-425s1c1
Sequence:CCGGCGAGAAACCTTCTGGTGTATTCTCGAGAATACACCAGAAGGTTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175681.2-511s1c1
Sequence:CCGGCCTGTCCTTCATACTTACCTTCTCGAGAAGGTAAGTATGAAGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175681.2-1779s1c1
Sequence:CCGGGCCAATACCATGGAGGAGATTCTCGAGAATCTCCTCCATGGTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks