EMAIL THIS PAGE TO A FRIEND

GLRA1

glycine receptor, alpha 1

62 Gene Product Result for
Synonyms: HKPX1 STHE
UniProtKB ID: P23415, B2R6T3, Q14C77, Q6DJV9
Gene ID:
Human(2741) Summary: The protein encoded by this gene is a subunit of a pentameric inhibitory glycine receptor. The receptor mediates postsynaptic inhibition in the central nervous system. Defects in this gene are a cause of startle disease (STHE), also known as hereditary hyperekplexia or congenital stiff-person syndrome. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2009]
Mouse(14654) glycine receptor, alpha 1 subunit
Rat(25674) glycine receptor, alpha 1
Zebrafish(30676) glycine receptor, alpha 1
cow(281783) glycine receptor, alpha 1
Horse(100060055) glycine receptor, alpha 1
domestic cat(101099022) glycine receptor, alpha 1
chicken(427637) glycine receptor, alpha 1
dog(489172) glycine receptor, alpha 1
domestic guinea pig(100271906) glycine receptor, alpha 1 subunit
naked mole-rat(101726680) glycine receptor, alpha 1
sheep(101107093) glycine receptor, alpha 1
Domestic Rabbit(100344552) glycine receptor, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000171 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000171 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000171 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020492 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020492 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020492 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000171 Rosetta Predictions human pricing
NM_013133 Rosetta Predictions rat pricing
NM_020492 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189268 predicted 856
2 SASI_Hs01_00189269 predicted 1255
3 SASI_Hs01_00189270 predicted 852
4 SASI_Hs01_00189271 predicted 531
5 SASI_Hs01_00189273 predicted 745
6 SASI_Hs01_00189274 predicted 812
7 SASI_Hs01_00189275 predicted 947
8 SASI_Hs01_00189276 predicted 839
9 SASI_Hs01_00189277 predicted 1426
10 SASI_Hs02_00302005 predicted 842
11 SASI_Hs01_00189272 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069298 predicted 1192
2 SASI_Rn01_00069300 predicted 740
3 SASI_Rn01_00069301 predicted 727
4 SASI_Rn01_00069302 predicted 197
5 SASI_Rn01_00069303 predicted 720
6 SASI_Rn01_00069304 predicted 407
7 SASI_Rn02_00260929 predicted 381
8 SASI_Rn01_00069305 predicted 896
9 SASI_Rn01_00069306 predicted 373
10 SASI_Rn02_00260930 predicted 863
11 SASI_Rn01_00069297 predicted 854
12 SASI_Rn01_00069299 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020492 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038062 predicted 589
2 SASI_Mm01_00038065 predicted 605
3 SASI_Mm01_00038066 predicted 489
4 SASI_Mm02_00325541 predicted 243
5 SASI_Mm01_00038067 predicted 610
6 SASI_Mm01_00038068 predicted 726
7 SASI_Mm01_00038069 predicted 1066
8 SASI_Mm01_00038070 predicted 802
9 SASI_Mm01_00038071 predicted 740
10 SASI_Mm02_00325542 predicted 572
11 SASI_Mm01_00038063 predicted 244
12 SASI_Mm01_00038064 predicted 472
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000171
GLRA1 MISSION shRNA Bacterial Glycerol Stock
glycine receptor, alpha 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000171.1-1376s1c1
Sequence:CCGGCCGCTTTAACTTCTCTGCCTACTCGAGTAGGCAGAGAAGTTAAAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000171.1-1203s1c1
Sequence:CCGGCCCAAGGTGTCCTATGTGAAACTCGAGTTTCACATAGGACACCTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000171.1-1527s1c1
Sequence:CCGGAGGGCCAAGAAGATCGACAAACTCGAGTTTGTCGATCTTCTTGGCCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000171.1-1034s1c1
Sequence:CCGGGCAGATGGGTTACTACCTGATCTCGAGATCAGGTAGTAACCCATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000171.1-980s1c1
Sequence:CCGGGCACTACAACACAGGTAAATTCTCGAGAATTTACCTGTGTTGTAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000171
GLRA1 MISSION shRNA shRNA Plasmid DNA
glycine receptor, alpha 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000171.1-1376s1c1
Sequence:CCGGCCGCTTTAACTTCTCTGCCTACTCGAGTAGGCAGAGAAGTTAAAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000171.1-1203s1c1
Sequence:CCGGCCCAAGGTGTCCTATGTGAAACTCGAGTTTCACATAGGACACCTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000171.1-1527s1c1
Sequence:CCGGAGGGCCAAGAAGATCGACAAACTCGAGTTTGTCGATCTTCTTGGCCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000171.1-1034s1c1
Sequence:CCGGGCAGATGGGTTACTACCTGATCTCGAGATCAGGTAGTAACCCATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000171.1-980s1c1
Sequence:CCGGGCACTACAACACAGGTAAATTCTCGAGAATTTACCTGTGTTGTAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000171
GLRA1 MISSION shRNA Lentiviral Transduction Particles
glycine receptor, alpha 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000171.1-1376s1c1
Sequence:CCGGCCGCTTTAACTTCTCTGCCTACTCGAGTAGGCAGAGAAGTTAAAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000171.1-1203s1c1
Sequence:CCGGCCCAAGGTGTCCTATGTGAAACTCGAGTTTCACATAGGACACCTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000171.1-1527s1c1
Sequence:CCGGAGGGCCAAGAAGATCGACAAACTCGAGTTTGTCGATCTTCTTGGCCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000171.1-1034s1c1
Sequence:CCGGGCAGATGGGTTACTACCTGATCTCGAGATCAGGTAGTAACCCATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000171.1-980s1c1
Sequence:CCGGGCACTACAACACAGGTAAATTCTCGAGAATTTACCTGTGTTGTAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020492
GLRA1 MISSION shRNA Bacterial Glycerol Stock
glycine receptor, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020492.2-479s1c1
Sequence:CCGGCGGACAACAAACTGCTAAGAACTCGAGTTCTTAGCAGTTTGTTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020492.2-476s1c1
Sequence:CCGGCCACGGACAACAAACTGCTAACTCGAGTTAGCAGTTTGTTGTCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020492.2-593s1c1
Sequence:CCGGCGTGTATCATGCAACTCGAAACTCGAGTTTCGAGTTGCATGATACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020492.2-750s1c1
Sequence:CCGGCACAGGTAAATTCACCTGCATCTCGAGATGCAGGTGAATTTACCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020492.2-970s1c1
Sequence:CCGGGTGTCCTACGTGAAAGCTATTCTCGAGAATAGCTTTCACGTAGGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020492
GLRA1 MISSION shRNA shRNA Plasmid DNA
glycine receptor, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020492.2-479s1c1
Sequence:CCGGCGGACAACAAACTGCTAAGAACTCGAGTTCTTAGCAGTTTGTTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020492.2-476s1c1
Sequence:CCGGCCACGGACAACAAACTGCTAACTCGAGTTAGCAGTTTGTTGTCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020492.2-593s1c1
Sequence:CCGGCGTGTATCATGCAACTCGAAACTCGAGTTTCGAGTTGCATGATACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020492.2-750s1c1
Sequence:CCGGCACAGGTAAATTCACCTGCATCTCGAGATGCAGGTGAATTTACCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020492.2-970s1c1
Sequence:CCGGGTGTCCTACGTGAAAGCTATTCTCGAGAATAGCTTTCACGTAGGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020492
GLRA1 MISSION shRNA Lentiviral Transduction Particles
glycine receptor, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020492.2-479s1c1
Sequence:CCGGCGGACAACAAACTGCTAAGAACTCGAGTTCTTAGCAGTTTGTTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020492.2-476s1c1
Sequence:CCGGCCACGGACAACAAACTGCTAACTCGAGTTAGCAGTTTGTTGTCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020492.2-593s1c1
Sequence:CCGGCGTGTATCATGCAACTCGAAACTCGAGTTTCGAGTTGCATGATACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020492.2-750s1c1
Sequence:CCGGCACAGGTAAATTCACCTGCATCTCGAGATGCAGGTGAATTTACCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020492.2-970s1c1
Sequence:CCGGGTGTCCTACGTGAAAGCTATTCTCGAGAATAGCTTTCACGTAGGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)