EMAIL THIS PAGE TO A FRIEND

GLRA3

glycine receptor, alpha 3

101 Gene Product Result for
UniProtKB ID: O75311, D3DP44, O75816, Q5D0E3
Gene ID:
Human(8001) Summary: The GLRA3 gene encodes the alpha-3 subunit of the neuronal glycine receptor, a ligand-gated chloride channel composed of ligand-binding alpha and structural beta polypeptides (Kingsmore et al., 1994 [PubMed 7894176]
Mouse(110304) glycine receptor, alpha 3 subunit
Rat(114516) glycine receptor, alpha 3
Zebrafish(192124) glycine receptor, alpha 3
cow(614979) glycine receptor, alpha 3
cow(541160) glycine receptor, alpha 3
Horse(100060995) glycine receptor, alpha 3
domestic cat(101087398) glycine receptor, alpha 3
dog(486074) glycine receptor, alpha 3
chicken(422568) glycine receptor, alpha 3
domestic guinea pig(100726006) glycine receptor, alpha 3
naked mole-rat(101715370) glycine receptor, alpha 3
sheep(101119614) glycine receptor, alpha 3
Domestic Rabbit(100358671) glycine receptor, alpha 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080438 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080438 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080438 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006529 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082561 MISSION® esiRNA esiRNA human GLRA3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042543 Rosetta Predictions human pricing
NM_006529 Rosetta Predictions human pricing
NM_053724 Rosetta Predictions rat pricing
XM_579574 Rosetta Predictions rat pricing
NM_080438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310468 predicted 1009
2 SASI_Hs02_00310469 predicted 564
3 SASI_Hs02_00310470 predicted 716
4 SASI_Hs02_00310471 predicted 1184
5 SASI_Hs02_00310472 predicted 921
6 SASI_Hs02_00310473 predicted 699
7 SASI_Hs02_00310474 predicted 554
8 SASI_Hs02_00310475 predicted 1124
9 SASI_Hs02_00310476 predicted 1151
10 SASI_Hs02_00310477 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146773 predicted 1010
2 SASI_Hs01_00146775 predicted 564
3 SASI_Hs01_00146776 predicted 719
4 SASI_Hs01_00146778 predicted 1185
5 SASI_Hs02_00341766 predicted 927
6 SASI_Hs01_00146780 predicted 706
7 SASI_Hs02_00341767 predicted 556
8 SASI_Hs02_00341768 predicted 1125
9 SASI_Hs02_00341769 predicted 1158
10 SASI_Hs02_00341770 predicted 614
11 SASI_Hs01_00146772 predicted 1560
12 SASI_Hs01_00146774 predicted 440
13 SASI_Hs01_00146777 predicted 961
14 SASI_Hs01_00146779 predicted 660
15 SASI_Hs01_00146781 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055068 predicted 721
2 SASI_Rn02_00266490 predicted 557
3 SASI_Rn01_00055069 predicted 592
4 SASI_Rn01_00055071 predicted 252
5 SASI_Rn02_00266491 predicted 533
6 SASI_Rn02_00266492 predicted 557
7 SASI_Rn01_00055074 predicted 798
8 SASI_Rn01_00055075 predicted 974
9 SASI_Rn02_00266493 predicted 759
10 SASI_Rn02_00266494 predicted 479
11 SASI_Rn01_00055070 predicted 1763
12 SASI_Rn01_00055072 predicted 1097
13 SASI_Rn01_00055073 predicted 378
14 SASI_Rn01_00055076 predicted 1646
15 SASI_Rn01_00055077 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579574 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00195739 predicted 304
2 SASI_Rn01_00195740 predicted 304
3 SASI_Rn01_00195741 predicted 308
4 SASI_Rn01_00195742 predicted 308
5 SASI_Rn01_00195743 predicted 308
6 SASI_Rn01_00195744 predicted 314
7 SASI_Rn01_00195745 predicted 297
8 SASI_Rn01_00195746 predicted 309
9 SASI_Rn01_00195747 predicted 311
10 SASI_Rn01_00195748 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179106 predicted 876
2 SASI_Mm01_00179107 predicted 334
3 SASI_Mm02_00338095 predicted 587
4 SASI_Mm01_00179108 predicted 825
5 SASI_Mm01_00179110 predicted 377
6 SASI_Mm01_00179109 predicted 958
7 SASI_Mm01_00179111 predicted 544
8 SASI_Mm01_00179112 predicted 780
9 SASI_Mm01_00179113 predicted 837
10 SASI_Mm01_00179114 predicted 502
11 SASI_Mm01_00179105 predicted 323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080438
GLRA3 MISSION shRNA Bacterial Glycerol Stock
glycine receptor, alpha 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080438.1-331s1c1
Sequence:CCGGCCTGACGATTCATTAGACCTTCTCGAGAAGGTCTAATGAATCGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080438.1-420s1c1
Sequence:CCGGCCACGAAGTCACCACAGATAACTCGAGTTATCTGTGGTGACTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080438.1-423s1c1
Sequence:CCGGCGAAGTCACCACAGATAACAACTCGAGTTGTTATCTGTGGTGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080438.1-649s1c1
Sequence:CCGGCCTCAATTTCTGTTGAAAGAACTCGAGTTCTTTCAACAGAAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080438.1-320s1c1
Sequence:CCGGCATACAGTTATCCTGACGATTCTCGAGAATCGTCAGGATAACTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080438
GLRA3 MISSION shRNA shRNA Plasmid DNA
glycine receptor, alpha 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080438.1-331s1c1
Sequence:CCGGCCTGACGATTCATTAGACCTTCTCGAGAAGGTCTAATGAATCGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080438.1-420s1c1
Sequence:CCGGCCACGAAGTCACCACAGATAACTCGAGTTATCTGTGGTGACTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080438.1-423s1c1
Sequence:CCGGCGAAGTCACCACAGATAACAACTCGAGTTGTTATCTGTGGTGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080438.1-649s1c1
Sequence:CCGGCCTCAATTTCTGTTGAAAGAACTCGAGTTCTTTCAACAGAAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080438.1-320s1c1
Sequence:CCGGCATACAGTTATCCTGACGATTCTCGAGAATCGTCAGGATAACTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080438
GLRA3 MISSION shRNA Lentiviral Transduction Particles
glycine receptor, alpha 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080438.1-331s1c1
Sequence:CCGGCCTGACGATTCATTAGACCTTCTCGAGAAGGTCTAATGAATCGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080438.1-420s1c1
Sequence:CCGGCCACGAAGTCACCACAGATAACTCGAGTTATCTGTGGTGACTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080438.1-423s1c1
Sequence:CCGGCGAAGTCACCACAGATAACAACTCGAGTTGTTATCTGTGGTGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080438.1-649s1c1
Sequence:CCGGCCTCAATTTCTGTTGAAAGAACTCGAGTTCTTTCAACAGAAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080438.1-320s1c1
Sequence:CCGGCATACAGTTATCCTGACGATTCTCGAGAATCGTCAGGATAACTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006529
GLRA3 MISSION shRNA Bacterial Glycerol Stock
glycine receptor, alpha 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006529.1-478s1c1
Sequence:CCGGGCACTGTTACTCAGTTTGGTTCTCGAGAACCAAACTGAGTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006529.1-620s1c1
Sequence:CCGGGCCCTCCAGTTAATGTCACATCTCGAGATGTGACATTAACTGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006529.1-999s1c1
Sequence:CCGGGTACACAATGAATGATCTCATCTCGAGATGAGATCATTCATTGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006529.1-1588s1c1
Sequence:CCGGCCATGTCTACAAGCAAAGGATCTCGAGATCCTTTGCTTGTAGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006529.1-1792s1c1
Sequence:CCGGGATATTCATCATCAGCAGCAACTCGAGTTGCTGCTGATGATGAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006529.2-1212s21c1
Sequence:CCGGACAGGAAAGTTTACGTGTATACTCGAGTATACACGTAAACTTTCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006529.2-1252s21c1
Sequence:CCGGAGCGACAAATGGGATACTATCCTCGAGGATAGTATCCCATTTGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006529.2-1839s21c1
Sequence:CCGGTTCTACTGGGTTATCTATAAACTCGAGTTTATAGATAACCCAGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006529
GLRA3 MISSION shRNA shRNA Plasmid DNA
glycine receptor, alpha 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006529.1-478s1c1
Sequence:CCGGGCACTGTTACTCAGTTTGGTTCTCGAGAACCAAACTGAGTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006529.1-620s1c1
Sequence:CCGGGCCCTCCAGTTAATGTCACATCTCGAGATGTGACATTAACTGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006529.1-999s1c1
Sequence:CCGGGTACACAATGAATGATCTCATCTCGAGATGAGATCATTCATTGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006529.1-1588s1c1
Sequence:CCGGCCATGTCTACAAGCAAAGGATCTCGAGATCCTTTGCTTGTAGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006529.1-1792s1c1
Sequence:CCGGGATATTCATCATCAGCAGCAACTCGAGTTGCTGCTGATGATGAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006529.2-1212s21c1
Sequence:CCGGACAGGAAAGTTTACGTGTATACTCGAGTATACACGTAAACTTTCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006529.2-1252s21c1
Sequence:CCGGAGCGACAAATGGGATACTATCCTCGAGGATAGTATCCCATTTGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006529.2-1839s21c1
Sequence:CCGGTTCTACTGGGTTATCTATAAACTCGAGTTTATAGATAACCCAGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006529
GLRA3 MISSION shRNA Lentiviral Transduction Particles
glycine receptor, alpha 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006529.1-478s1c1
Sequence:CCGGGCACTGTTACTCAGTTTGGTTCTCGAGAACCAAACTGAGTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006529.1-620s1c1
Sequence:CCGGGCCCTCCAGTTAATGTCACATCTCGAGATGTGACATTAACTGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006529.1-999s1c1
Sequence:CCGGGTACACAATGAATGATCTCATCTCGAGATGAGATCATTCATTGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006529.1-1588s1c1
Sequence:CCGGCCATGTCTACAAGCAAAGGATCTCGAGATCCTTTGCTTGTAGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006529.1-1792s1c1
Sequence:CCGGGATATTCATCATCAGCAGCAACTCGAGTTGCTGCTGATGATGAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006529.2-1212s21c1
Sequence:CCGGACAGGAAAGTTTACGTGTATACTCGAGTATACACGTAAACTTTCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006529.2-1252s21c1
Sequence:CCGGAGCGACAAATGGGATACTATCCTCGAGGATAGTATCCCATTTGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006529.2-1839s21c1
Sequence:CCGGTTCTACTGGGTTATCTATAAACTCGAGTTTATAGATAACCCAGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks