EMAIL THIS PAGE TO A FRIEND

GLRA4

glycine receptor, alpha 4

53 Gene Product Result for
UniProtKB ID: Q5JXX5
Gene ID:
Human(441509) Summary: This gene encodes a protein which has a neurotransmitter-gated ion-channel ligand binding domain. The encoded protein is very similar to a mouse protein which is a subunit of the retinal glycine receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(14657) glycine receptor, alpha 4 subunit
Rat(367912) glycine receptor, alpha 4
sheep(101120810) glycine receptor, alpha 4
domestic guinea pig(100723095) glycine receptor, alpha 4
naked mole-rat(101700092) glycine receptor, alpha 4
chicken(769706) glycine receptor, alpha 4
dog(492035) glycine receptor, alpha 4
domestic cat(101098122) glycine receptor, alpha 4
cow(531678) glycine receptor, alpha 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024452 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010297 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010297 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010297 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020711 MISSION® esiRNA esiRNA human GLRA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024452 Rosetta Predictions human pricing
XM_001054481 Rosetta Predictions rat pricing
XM_346350 Rosetta Predictions rat pricing
NM_010297 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307146 predicted 555
2 SASI_Hs02_00307147 predicted 263
3 SASI_Hs02_00307148 predicted 349
4 SASI_Hs02_00307149 predicted 434
5 SASI_Hs02_00307150 predicted 628
6 SASI_Hs02_00307151 predicted 432
7 SASI_Hs02_00307152 predicted 458
8 SASI_Hs02_00307153 predicted 302
9 SASI_Hs02_00307154 predicted 630
10 SASI_Hs02_00307155 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275948 predicted 612
2 SASI_Rn02_00275949 predicted 1161
3 SASI_Rn02_00275950 predicted 1507
4 SASI_Rn02_00275951 predicted 1127
5 SASI_Rn02_00275952 predicted 1400
6 SASI_Rn02_00275953 predicted 1022
7 SASI_Rn02_00275954 predicted 946
8 SASI_Rn02_00275955 predicted 594
9 SASI_Rn02_00275956 predicted 1597
10 SASI_Rn02_00275957 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_346350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399324 predicted 611
2 SASI_Rn02_00399325 predicted 1160
3 SASI_Rn02_00399326 predicted 1511
4 SASI_Rn02_00399327 predicted 1124
5 SASI_Rn02_00399328 predicted 1394
6 SASI_Rn02_00399329 predicted 1020
7 SASI_Rn02_00399330 predicted 951
8 SASI_Rn02_00399331 predicted 593
9 SASI_Rn02_00399332 predicted 1600
10 SASI_Rn02_00399333 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010297 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318267 predicted 374
2 SASI_Mm01_00066068 predicted 735
3 SASI_Mm01_00066069 predicted 974
4 SASI_Mm01_00066070 predicted 592
5 SASI_Mm01_00066071 predicted 701
6 SASI_Mm01_00066072 predicted 567
7 SASI_Mm01_00066067 predicted 345
8 SASI_Mm02_00318268 predicted 1180
9 SASI_Mm01_00066073 predicted 695
10 SASI_Mm01_00066074 predicted 583
11 SASI_Mm01_00066075 predicted 335
12 SASI_Mm01_00066076 predicted 772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024452
GLRA4 MISSION shRNA Bacterial Glycerol Stock
glycine receptor, alpha 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000265602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024452.2-909s21c1
Sequence:CCGGGCATCAGGCTGACCCTCATTTCTCGAGAAATGAGGGTCAGCCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024452.2-1423s21c1
Sequence:CCGGGGAGTATGCTGCCATAAATTTCTCGAGAAATTTATGGCAGCATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024452.2-556s21c1
Sequence:CCGGTGATTTCCTAGACAAACTTATCTCGAGATAAGTTTGTCTAGGAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024452.2-1008s21c1
Sequence:CCGGCCATGAAAGACCTCGTGTTTGCTCGAGCAAACACGAGGTCTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024452
GLRA4 MISSION shRNA shRNA Plasmid DNA
glycine receptor, alpha 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000265602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024452.2-909s21c1
Sequence:CCGGGCATCAGGCTGACCCTCATTTCTCGAGAAATGAGGGTCAGCCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024452.2-1423s21c1
Sequence:CCGGGGAGTATGCTGCCATAAATTTCTCGAGAAATTTATGGCAGCATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024452.2-556s21c1
Sequence:CCGGTGATTTCCTAGACAAACTTATCTCGAGATAAGTTTGTCTAGGAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024452.2-1008s21c1
Sequence:CCGGCCATGAAAGACCTCGTGTTTGCTCGAGCAAACACGAGGTCTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024452
GLRA4 MISSION shRNA Lentiviral Transduction Particles
glycine receptor, alpha 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000265602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024452.2-909s21c1
Sequence:CCGGGCATCAGGCTGACCCTCATTTCTCGAGAAATGAGGGTCAGCCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024452.2-1423s21c1
Sequence:CCGGGGAGTATGCTGCCATAAATTTCTCGAGAAATTTATGGCAGCATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024452.2-556s21c1
Sequence:CCGGTGATTTCCTAGACAAACTTATCTCGAGATAAGTTTGTCTAGGAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024452.2-1008s21c1
Sequence:CCGGCCATGAAAGACCTCGTGTTTGCTCGAGCAAACACGAGGTCTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010297
GLRA4 MISSION shRNA Bacterial Glycerol Stock
glycine receptor, alpha 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010297.1-365s1c1
Sequence:CCGGGCATCAGATTGACCCTCATTTCTCGAGAAATGAGGGTCAATCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010297.1-44s1c1
Sequence:CCGGCTGGATATGATGCTAGGATTACTCGAGTAATCCTAGCATCATATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010297.1-567s1c1
Sequence:CCGGAGGGTATTGTACCAAGCACTACTCGAGTAGTGCTTGGTACAATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010297.1-199s1c1
Sequence:CCGGGCCTACCGAGAATATCCAGATCTCGAGATCTGGATATTCTCGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010297.1-52s1c1
Sequence:CCGGGATGCTAGGATTAGGCCCAATCTCGAGATTGGGCCTAATCCTAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010297
GLRA4 MISSION shRNA shRNA Plasmid DNA
glycine receptor, alpha 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010297.1-365s1c1
Sequence:CCGGGCATCAGATTGACCCTCATTTCTCGAGAAATGAGGGTCAATCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010297.1-44s1c1
Sequence:CCGGCTGGATATGATGCTAGGATTACTCGAGTAATCCTAGCATCATATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010297.1-567s1c1
Sequence:CCGGAGGGTATTGTACCAAGCACTACTCGAGTAGTGCTTGGTACAATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010297.1-199s1c1
Sequence:CCGGGCCTACCGAGAATATCCAGATCTCGAGATCTGGATATTCTCGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010297.1-52s1c1
Sequence:CCGGGATGCTAGGATTAGGCCCAATCTCGAGATTGGGCCTAATCCTAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010297
GLRA4 MISSION shRNA Lentiviral Transduction Particles
glycine receptor, alpha 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010297.1-365s1c1
Sequence:CCGGGCATCAGATTGACCCTCATTTCTCGAGAAATGAGGGTCAATCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010297.1-44s1c1
Sequence:CCGGCTGGATATGATGCTAGGATTACTCGAGTAATCCTAGCATCATATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010297.1-567s1c1
Sequence:CCGGAGGGTATTGTACCAAGCACTACTCGAGTAGTGCTTGGTACAATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010297.1-199s1c1
Sequence:CCGGGCCTACCGAGAATATCCAGATCTCGAGATCTGGATATTCTCGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010297.1-52s1c1
Sequence:CCGGGATGCTAGGATTAGGCCCAATCTCGAGATTGGGCCTAATCCTAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks