EMAIL THIS PAGE TO A FRIEND

GLRB

glycine receptor, beta

89 Gene Product Result for
Synonyms: HKPX2
UniProtKB ID: P48167, A8K3K2, D3DP23, F5GWE1
Gene ID:
Human(2743) Summary: This gene encodes the beta subunit of the glycine receptor, which is a pentamer composed of alpha and beta subunits. The receptor functions as a neurotransmitter-gated ion channel, which produces hyperpolarization via increased chloride conductance due to the binding of glycine to the receptor. Mutations in this gene cause startle disease, also known as hereditary hyperekplexia or congenital stiff-person syndrome, a disease characterized by muscular rigidity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(14658) glycine receptor, beta subunit
Rat(25456) glycine receptor, beta
chicken(422411) glycine receptor, beta
cow(281198) glycine receptor, beta
Horse(100061981) glycine receptor, beta
domestic cat(101088482) glycine receptor, beta
dog(475477) glycine receptor, beta
domestic guinea pig(100727431) glycine receptor, beta
naked mole-rat(101709956) glycine receptor, beta
sheep(101109484) glycine receptor, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010298 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010298 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010298 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000824 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000824 Rosetta Predictions human pricing
NM_053296 Rosetta Predictions rat pricing
NM_010298 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114429 predicted 1522
2 SASI_Hs01_00114430 predicted 1447
3 SASI_Hs01_00114431 predicted 491
4 SASI_Hs01_00114433 predicted 800
5 SASI_Hs01_00114434 predicted 1437
6 SASI_Hs01_00114435 predicted 965
7 SASI_Hs01_00114436 predicted 709
8 SASI_Hs01_00114437 predicted 1458
9 SASI_Hs01_00114438 predicted 599
10 SASI_Hs02_00303301 predicted 1494
11 SASI_Hs01_00114432 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067902 predicted 285
2 SASI_Rn01_00067903 predicted 286
3 SASI_Rn01_00067905 predicted 280
4 SASI_Rn01_00067906 predicted 1131
5 SASI_Rn02_00265677 predicted 531
6 SASI_Rn01_00067907 predicted 592
7 SASI_Rn01_00067908 predicted 1230
8 SASI_Rn02_00265678 predicted 915
9 SASI_Rn01_00067909 predicted 1132
10 SASI_Rn01_00067910 predicted 1180
11 SASI_Rn01_00067901 predicted 1038
12 SASI_Rn01_00067904 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159751 predicted 1604
2 SASI_Mm01_00159752 predicted 735
3 SASI_Mm01_00159753 predicted 955
4 SASI_Mm01_00159754 predicted 727
5 SASI_Mm01_00159755 predicted 744
6 SASI_Mm01_00159756 predicted 1375
7 SASI_Mm01_00159757 predicted 1090
8 SASI_Mm01_00159758 predicted 423
9 SASI_Mm01_00159759 predicted 1391
10 SASI_Mm01_00159760 predicted 1315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010298
GLRB MISSION shRNA Bacterial Glycerol Stock
glycine receptor, beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010298.3-2373s1c1
Sequence:CCGGCCACCTTAAATCAAAGTCTATCTCGAGATAGACTTTGATTTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010298.3-1279s1c1
Sequence:CCGGGCAGCTAAGAAGAATACTGTACTCGAGTACAGTATTCTTCTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010298.3-1095s1c1
Sequence:CCGGCGAGCTTCCTAAAGTGTCTTACTCGAGTAAGACACTTTAGGAAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010298.3-1560s1c1
Sequence:CCGGCCTTTATGCAAGAGCATTATTCTCGAGAATAATGCTCTTGCATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010298.3-182s1c1
Sequence:CCGGCCTTGTTGTTTGAAGACGCTTCTCGAGAAGCGTCTTCAAACAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010298
GLRB MISSION shRNA shRNA Plasmid DNA
glycine receptor, beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010298.3-2373s1c1
Sequence:CCGGCCACCTTAAATCAAAGTCTATCTCGAGATAGACTTTGATTTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010298.3-1279s1c1
Sequence:CCGGGCAGCTAAGAAGAATACTGTACTCGAGTACAGTATTCTTCTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010298.3-1095s1c1
Sequence:CCGGCGAGCTTCCTAAAGTGTCTTACTCGAGTAAGACACTTTAGGAAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010298.3-1560s1c1
Sequence:CCGGCCTTTATGCAAGAGCATTATTCTCGAGAATAATGCTCTTGCATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010298.3-182s1c1
Sequence:CCGGCCTTGTTGTTTGAAGACGCTTCTCGAGAAGCGTCTTCAAACAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010298
GLRB MISSION shRNA Lentiviral Transduction Particles
glycine receptor, beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010298.3-2373s1c1
Sequence:CCGGCCACCTTAAATCAAAGTCTATCTCGAGATAGACTTTGATTTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010298.3-1279s1c1
Sequence:CCGGGCAGCTAAGAAGAATACTGTACTCGAGTACAGTATTCTTCTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010298.3-1095s1c1
Sequence:CCGGCGAGCTTCCTAAAGTGTCTTACTCGAGTAAGACACTTTAGGAAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010298.3-1560s1c1
Sequence:CCGGCCTTTATGCAAGAGCATTATTCTCGAGAATAATGCTCTTGCATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010298.3-182s1c1
Sequence:CCGGCCTTGTTGTTTGAAGACGCTTCTCGAGAAGCGTCTTCAAACAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000824
GLRB MISSION shRNA Bacterial Glycerol Stock
glycine receptor, beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000824.2-1549s1c1
Sequence:CCGGGCAAAGCGAATTGATCTTTATCTCGAGATAAAGATCAATTCGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000824.2-691s1c1
Sequence:CCGGCCTTTGGACTTGACATTGTTTCTCGAGAAACAATGTCAAGTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000824.2-1137s1c1
Sequence:CCGGGCTTATTGCTTGCCTTCTCTTCTCGAGAAGAGAAGGCAAGCAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000824.2-321s1c1
Sequence:CCGGGAACAGGTTATTGGTCAGTTACTCGAGTAACTGACCAATAACCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000824.2-535s1c1
Sequence:CCGGCCAACAATGTACAAGTGTTTACTCGAGTAAACACTTGTACATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000824.4-824s21c1
Sequence:CCGGACTGATGATTTACGATTTATCCTCGAGGATAAATCGTAAATCATCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000824.4-358s21c1
Sequence:CCGGTGCCAACTCCACTAGCAATATCTCGAGATATTGCTAGTGGAGTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000824.4-1437s21c1
Sequence:CCGGAGTCTGATCTGAGATCTAATGCTCGAGCATTAGATCTCAGATCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000824.4-1875s21c1
Sequence:CCGGGTGCTCTAATAACGATGTATACTCGAGTATACATCGTTATTAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000824.4-719s21c1
Sequence:CCGGGTCAGCATGAGGTTATCTATTCTCGAGAATAGATAACCTCATGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000824
GLRB MISSION shRNA shRNA Plasmid DNA
glycine receptor, beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000824.2-1549s1c1
Sequence:CCGGGCAAAGCGAATTGATCTTTATCTCGAGATAAAGATCAATTCGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000824.2-691s1c1
Sequence:CCGGCCTTTGGACTTGACATTGTTTCTCGAGAAACAATGTCAAGTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000824.2-1137s1c1
Sequence:CCGGGCTTATTGCTTGCCTTCTCTTCTCGAGAAGAGAAGGCAAGCAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000824.2-321s1c1
Sequence:CCGGGAACAGGTTATTGGTCAGTTACTCGAGTAACTGACCAATAACCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000824.2-535s1c1
Sequence:CCGGCCAACAATGTACAAGTGTTTACTCGAGTAAACACTTGTACATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000824.4-824s21c1
Sequence:CCGGACTGATGATTTACGATTTATCCTCGAGGATAAATCGTAAATCATCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000824.4-358s21c1
Sequence:CCGGTGCCAACTCCACTAGCAATATCTCGAGATATTGCTAGTGGAGTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000824.4-1437s21c1
Sequence:CCGGAGTCTGATCTGAGATCTAATGCTCGAGCATTAGATCTCAGATCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000824.4-1875s21c1
Sequence:CCGGGTGCTCTAATAACGATGTATACTCGAGTATACATCGTTATTAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000824.4-719s21c1
Sequence:CCGGGTCAGCATGAGGTTATCTATTCTCGAGAATAGATAACCTCATGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000824
GLRB MISSION shRNA Lentiviral Transduction Particles
glycine receptor, beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000824.2-1549s1c1
Sequence:CCGGGCAAAGCGAATTGATCTTTATCTCGAGATAAAGATCAATTCGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000824.2-691s1c1
Sequence:CCGGCCTTTGGACTTGACATTGTTTCTCGAGAAACAATGTCAAGTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000824.2-1137s1c1
Sequence:CCGGGCTTATTGCTTGCCTTCTCTTCTCGAGAAGAGAAGGCAAGCAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000824.2-321s1c1
Sequence:CCGGGAACAGGTTATTGGTCAGTTACTCGAGTAACTGACCAATAACCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000824.2-535s1c1
Sequence:CCGGCCAACAATGTACAAGTGTTTACTCGAGTAAACACTTGTACATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000824.4-824s21c1
Sequence:CCGGACTGATGATTTACGATTTATCCTCGAGGATAAATCGTAAATCATCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000824.4-358s21c1
Sequence:CCGGTGCCAACTCCACTAGCAATATCTCGAGATATTGCTAGTGGAGTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000824.4-1437s21c1
Sequence:CCGGAGTCTGATCTGAGATCTAATGCTCGAGCATTAGATCTCAGATCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000824.4-1875s21c1
Sequence:CCGGGTGCTCTAATAACGATGTATACTCGAGTATACATCGTTATTAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000824.4-719s21c1
Sequence:CCGGGTCAGCATGAGGTTATCTATTCTCGAGAATAGATAACCTCATGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks