EMAIL THIS PAGE TO A FRIEND

GLRX2

glutaredoxin 2

113 Gene Product Result for
Synonyms: CGI-133 GRX2
UniProtKB ID: Q9NS18, Q3LR69, Q7L1N7, Q96JC0, Q9Y3D4
Gene ID:
Human(51022) Summary: The protein encoded by this gene is a member of the glutaredoxin family of proteins, which maintain cellular thiol homeostasis. These proteins are thiol-disulfide oxidoreductases that use a glutathione-binding site and one or two active cysteines in their active site. This gene undergoes alternative splicing to produce multiple isoforms, one of which is ubiquitously expressed and localizes to mitochondria, where it functions in mitochondrial redox homeostasis and is important for the protection against and recovery from oxidative stress. Other isoforms, which have more restrictive expression patterns, show cytosolic and nuclear localization, and are thought to function in cellular differentiation and transformation, possibly with a role in tumor progression. [provided by RefSeq, Aug 2011]
Mouse(69367) glutaredoxin 2 (thioltransferase)
Rat(114022) glutaredoxin 2
Zebrafish(436677) glutaredoxin 2
chicken(424357) glutaredoxin 2
dog(478956) glutaredoxin 2
domestic cat(101091421) glutaredoxin 2
cow(513762) glutaredoxin 2
naked mole-rat(101697695) glutaredoxin 2
sheep(100135692) glutaredoxin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023505 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023505 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023505 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016066 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141551 MISSION® esiRNA esiRNA human GLRX2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016066 Rosetta Predictions human pricing
NM_197962 Rosetta Predictions human pricing
NM_001013034 Rosetta Predictions rat pricing
NM_001038592 Rosetta Predictions mouse pricing
NM_001038593 Rosetta Predictions mouse pricing
NM_001038594 Rosetta Predictions mouse pricing
NM_023505 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230009 predicted 879
2 SASI_Hs01_00230010 predicted 709
3 SASI_Hs01_00230011 predicted 833
4 SASI_Hs01_00230012 predicted 819
5 SASI_Hs01_00230013 predicted 1066
6 SASI_Hs01_00230014 predicted 699
7 SASI_Hs01_00230015 predicted 602
8 SASI_Hs01_00230017 predicted 825
9 SASI_Hs02_00348802 predicted 609
10 SASI_Hs02_00348803 predicted 789
11 SASI_Hs01_00230008 predicted 747
12 SASI_Hs01_00230016 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231772 predicted 231
2 SASI_Hs01_00231773 predicted 445
3 SASI_Hs01_00231775 predicted 444
4 SASI_Hs01_00231778 predicted 404
5 SASI_Hs01_00231779 predicted 552
6 SASI_Hs01_00231780 predicted 389
7 SASI_Hs01_00231781 predicted 203
8 SASI_Hs02_00371567 predicted 223
9 SASI_Hs02_00371568 predicted 627
10 SASI_Hs02_00371569 predicted 264
11 SASI_Hs01_00231774 predicted 306
12 SASI_Hs01_00231776 predicted 574
13 SASI_Hs01_00231777 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106337 predicted 273
2 SASI_Rn02_00200617 predicted 291
3 SASI_Rn01_00106338 predicted 654
4 SASI_Rn01_00106339 predicted 778
5 SASI_Rn01_00106340 predicted 543
6 SASI_Rn01_00106341 predicted 368
7 SASI_Rn01_00106342 predicted 409
8 SASI_Rn01_00106343 predicted 732
9 SASI_Rn01_00106344 predicted 754
10 SASI_Rn01_00106345 predicted 742
11 SASI_Rn01_00106346 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038592 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033600 predicted 948
2 SASI_Mm01_00033601 predicted 895
3 SASI_Mm02_00289601 predicted 298
4 SASI_Mm02_00289602 predicted 247
5 SASI_Mm02_00289603 predicted 767
6 SASI_Mm01_00033607 predicted 233
7 SASI_Mm01_00033608 predicted 371
8 SASI_Mm01_00033609 predicted 852
9 SASI_Mm02_00289604 predicted 262
10 SASI_Mm02_00289605 predicted 774
11 SASI_Mm01_00033602 predicted 574
12 SASI_Mm01_00033603 predicted 441
13 SASI_Mm01_00033604 predicted 501
14 SASI_Mm01_00033605 predicted 615
15 SASI_Mm01_00033606 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038593 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059816 predicted 848
2 SASI_Mm01_00059817 predicted 792
3 SASI_Mm02_00289606 predicted 204
4 SASI_Mm02_00289607 predicted 149
5 SASI_Mm02_00289608 predicted 677
6 SASI_Mm01_00059823 predicted 138
7 SASI_Mm01_00059824 predicted 276
8 SASI_Mm01_00059825 predicted 751
9 SASI_Mm02_00289609 predicted 160
10 SASI_Mm02_00289610 predicted 676
11 SASI_Mm01_00059818 predicted 478
12 SASI_Mm01_00059819 predicted 343
13 SASI_Mm01_00059820 predicted 408
14 SASI_Mm01_00059821 predicted 522
15 SASI_Mm01_00059822 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200430 predicted 790
2 SASI_Mm01_00200431 predicted 734
3 SASI_Mm02_00289611 predicted 141
4 SASI_Mm02_00289612 predicted 94
5 SASI_Mm02_00289613 predicted 615
6 SASI_Mm01_00200437 predicted 76
7 SASI_Mm01_00200438 predicted 215
8 SASI_Mm01_00200439 predicted 693
9 SASI_Mm02_00289614 predicted 104
10 SASI_Mm02_00289615 predicted 613
11 SASI_Mm01_00200432 predicted 412
12 SASI_Mm01_00200433 predicted 276
13 SASI_Mm01_00200434 predicted 347
14 SASI_Mm01_00200435 predicted 453
15 SASI_Mm01_00200436 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049783 predicted 826
2 SASI_Mm01_00049784 predicted 767
3 SASI_Mm02_00327152 predicted 174
4 SASI_Mm02_00327153 predicted 127
5 SASI_Mm02_00327154 predicted 650
6 SASI_Mm01_00049790 predicted 109
7 SASI_Mm01_00049791 predicted 254
8 SASI_Mm01_00049792 predicted 732
9 SASI_Mm02_00327155 predicted 143
10 SASI_Mm02_00327156 predicted 659
11 SASI_Mm01_00049785 predicted 448
12 SASI_Mm01_00049786 predicted 313
13 SASI_Mm01_00049787 predicted 382
14 SASI_Mm01_00049788 predicted 495
15 SASI_Mm01_00049789 predicted 477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023505
GLRX2 MISSION shRNA Bacterial Glycerol Stock
glutaredoxin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023505.2-101s21c1
Sequence:CCGGGAAGTCTACAACTACTCCTGTCTCGAGACAGGAGTAGTTGTAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023505.2-243s21c1
Sequence:CCGGGAGTTGGATATGCTGGAATATCTCGAGATATTCCAGCATATCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023505.2-124s21c1
Sequence:CCGGACCAGATCCAAGAAACAATTTCTCGAGAAATTGTTTCTTGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023505.2-258s21c1
Sequence:CCGGGAATATGGCAACCAGTTTCAACTCGAGTTGAAACTGGTTGCCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023505.2-215s21c1
Sequence:CCGGTGACATGAATGTCAACTACAACTCGAGTTGTAGTTGACATTCATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023505.1-210s1c1
Sequence:CCGGGAGTTGGATATGCTGGAATATCTCGAGATATTCCAGCATATCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023505.1-182s1c1
Sequence:CCGGTGACATGAATGTCAACTACAACTCGAGTTGTAGTTGACATTCATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023505.1-225s1c1
Sequence:CCGGGAATATGGCAACCAGTTTCAACTCGAGTTGAAACTGGTTGCCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023505.1-91s1c1
Sequence:CCGGACCAGATCCAAGAAACAATTTCTCGAGAAATTGTTTCTTGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023505.1-68s1c1
Sequence:CCGGGAAGTCTACAACTACTCCTGTCTCGAGACAGGAGTAGTTGTAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023505
GLRX2 MISSION shRNA shRNA Plasmid DNA
glutaredoxin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023505.2-101s21c1
Sequence:CCGGGAAGTCTACAACTACTCCTGTCTCGAGACAGGAGTAGTTGTAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023505.2-243s21c1
Sequence:CCGGGAGTTGGATATGCTGGAATATCTCGAGATATTCCAGCATATCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023505.2-124s21c1
Sequence:CCGGACCAGATCCAAGAAACAATTTCTCGAGAAATTGTTTCTTGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023505.2-258s21c1
Sequence:CCGGGAATATGGCAACCAGTTTCAACTCGAGTTGAAACTGGTTGCCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023505.2-215s21c1
Sequence:CCGGTGACATGAATGTCAACTACAACTCGAGTTGTAGTTGACATTCATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023505.1-210s1c1
Sequence:CCGGGAGTTGGATATGCTGGAATATCTCGAGATATTCCAGCATATCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023505.1-182s1c1
Sequence:CCGGTGACATGAATGTCAACTACAACTCGAGTTGTAGTTGACATTCATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023505.1-225s1c1
Sequence:CCGGGAATATGGCAACCAGTTTCAACTCGAGTTGAAACTGGTTGCCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023505.1-91s1c1
Sequence:CCGGACCAGATCCAAGAAACAATTTCTCGAGAAATTGTTTCTTGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023505.1-68s1c1
Sequence:CCGGGAAGTCTACAACTACTCCTGTCTCGAGACAGGAGTAGTTGTAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023505
GLRX2 MISSION shRNA Lentiviral Transduction Particles
glutaredoxin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023505.2-101s21c1
Sequence:CCGGGAAGTCTACAACTACTCCTGTCTCGAGACAGGAGTAGTTGTAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023505.2-243s21c1
Sequence:CCGGGAGTTGGATATGCTGGAATATCTCGAGATATTCCAGCATATCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023505.2-124s21c1
Sequence:CCGGACCAGATCCAAGAAACAATTTCTCGAGAAATTGTTTCTTGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023505.2-258s21c1
Sequence:CCGGGAATATGGCAACCAGTTTCAACTCGAGTTGAAACTGGTTGCCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023505.2-215s21c1
Sequence:CCGGTGACATGAATGTCAACTACAACTCGAGTTGTAGTTGACATTCATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023505.1-210s1c1
Sequence:CCGGGAGTTGGATATGCTGGAATATCTCGAGATATTCCAGCATATCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023505.1-182s1c1
Sequence:CCGGTGACATGAATGTCAACTACAACTCGAGTTGTAGTTGACATTCATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023505.1-225s1c1
Sequence:CCGGGAATATGGCAACCAGTTTCAACTCGAGTTGAAACTGGTTGCCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023505.1-91s1c1
Sequence:CCGGACCAGATCCAAGAAACAATTTCTCGAGAAATTGTTTCTTGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023505.1-68s1c1
Sequence:CCGGGAAGTCTACAACTACTCCTGTCTCGAGACAGGAGTAGTTGTAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016066
VALIDATED
GLRX2 MISSION shRNA Bacterial Glycerol Stock
glutaredoxin 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016066.3-673s21c1
Sequence:CCGGCTGATAATTGTGTGGTGATTTCTCGAGAAATCACCACACAATTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016066.3-921s21c1
Sequence:CCGGCCACTAGTTCATCAGTGTTATCTCGAGATAACACTGATGAACTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016066.3-645s21c1
Sequence:CCGGCCTGTGAACCAGATCCAAGAACTCGAGTTCTTGGATCTGGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016066.3-874s21c1
Sequence:CCGGGAGGTGCAACTGACACTCATACTCGAGTATGAGTGTCAGTTGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016066.3-645s1c1
Sequence:CCGGCCTGTGAACCAGATCCAAGAACTCGAGTTCTTGGATCTGGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016066.3-673s1c1
Sequence:CCGGCTGATAATTGTGTGGTGATTTCTCGAGAAATCACCACACAATTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016066.3-874s1c1
Sequence:CCGGGAGGTGCAACTGACACTCATACTCGAGTATGAGTGTCAGTTGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016066.3-921s1c1
Sequence:CCGGCCACTAGTTCATCAGTGTTATCTCGAGATAACACTGATGAACTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_016066.3-782s1c1
Sequence:CCGGGCTTGAATATGGAAACCAGTTCTCGAGAACTGGTTTCCATATTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016066
VALIDATED
GLRX2 MISSION shRNA shRNA Plasmid DNA
glutaredoxin 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016066.3-673s21c1
Sequence:CCGGCTGATAATTGTGTGGTGATTTCTCGAGAAATCACCACACAATTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016066.3-921s21c1
Sequence:CCGGCCACTAGTTCATCAGTGTTATCTCGAGATAACACTGATGAACTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016066.3-645s21c1
Sequence:CCGGCCTGTGAACCAGATCCAAGAACTCGAGTTCTTGGATCTGGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016066.3-874s21c1
Sequence:CCGGGAGGTGCAACTGACACTCATACTCGAGTATGAGTGTCAGTTGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016066.3-645s1c1
Sequence:CCGGCCTGTGAACCAGATCCAAGAACTCGAGTTCTTGGATCTGGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016066.3-673s1c1
Sequence:CCGGCTGATAATTGTGTGGTGATTTCTCGAGAAATCACCACACAATTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016066.3-874s1c1
Sequence:CCGGGAGGTGCAACTGACACTCATACTCGAGTATGAGTGTCAGTTGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016066.3-921s1c1
Sequence:CCGGCCACTAGTTCATCAGTGTTATCTCGAGATAACACTGATGAACTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_016066.3-782s1c1
Sequence:CCGGGCTTGAATATGGAAACCAGTTCTCGAGAACTGGTTTCCATATTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016066
VALIDATED
GLRX2 MISSION shRNA Lentiviral Transduction Particles
glutaredoxin 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016066.3-673s21c1
Sequence:CCGGCTGATAATTGTGTGGTGATTTCTCGAGAAATCACCACACAATTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016066.3-921s21c1
Sequence:CCGGCCACTAGTTCATCAGTGTTATCTCGAGATAACACTGATGAACTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016066.3-645s21c1
Sequence:CCGGCCTGTGAACCAGATCCAAGAACTCGAGTTCTTGGATCTGGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016066.3-874s21c1
Sequence:CCGGGAGGTGCAACTGACACTCATACTCGAGTATGAGTGTCAGTTGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016066.3-645s1c1
Sequence:CCGGCCTGTGAACCAGATCCAAGAACTCGAGTTCTTGGATCTGGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016066.3-673s1c1
Sequence:CCGGCTGATAATTGTGTGGTGATTTCTCGAGAAATCACCACACAATTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016066.3-874s1c1
Sequence:CCGGGAGGTGCAACTGACACTCATACTCGAGTATGAGTGTCAGTTGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016066.3-921s1c1
Sequence:CCGGCCACTAGTTCATCAGTGTTATCTCGAGATAACACTGATGAACTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_016066.3-782s1c1
Sequence:CCGGGCTTGAATATGGAAACCAGTTCTCGAGAACTGGTTTCCATATTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks