EMAIL THIS PAGE TO A FRIEND

GLRX3

glutaredoxin 3

100 Gene Product Result for
Synonyms: GLRX4 GRX3 GRX4 PICOT TXNL2 TXNL3
Gene ID:
Human(10539) Summary: This gene encodes a member of the glutaredoxin family. Glutaredoxins are oxidoreductase enzymes that reduce a variety of substrates using glutathione as a cofactor. The encoded protein binds to and modulates the function of protein kinase C theta. The encoded protein may also inhibit apoptosis and play a role in cellular growth, and the expression of this gene may be a marker for cancer. Pseudogenes of this gene are located on the short arm of chromosomes 6 and 9. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Mouse(30926) glutaredoxin 3
Rat(58815) glutaredoxin 3
sheep(101107402) glutaredoxin 3
naked mole-rat(101711590) glutaredoxin 3
Zebrafish(449777) glutaredoxin 3
chicken(423968) glutaredoxin 3
dog(477869) glutaredoxin 3
cow(511528) glutaredoxin 3
domestic cat(101085578) glutaredoxin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006541 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006541 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006541 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023140 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023140 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023140 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006541 Rosetta Predictions human pricing
NM_032614 Rosetta Predictions rat pricing
NM_023140 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124348 predicted 805
2 SASI_Hs01_00124349 predicted 996
3 SASI_Hs01_00124350 predicted 655
4 SASI_Hs01_00124351 predicted 917
5 SASI_Hs01_00124354 predicted 684
6 SASI_Hs01_00124355 predicted 823
7 SASI_Hs02_00341801 predicted 843
8 SASI_Hs02_00341802 predicted 995
9 SASI_Hs02_00341803 predicted 803
10 SASI_Hs01_00124352 predicted 858
11 SASI_Hs01_00124347 predicted 769
12 SASI_Hs01_00124353 predicted 391
13 SASI_Hs01_00124356 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032614 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080229 predicted 996
2 SASI_Rn01_00080230 predicted 629
3 SASI_Rn01_00080231 predicted 933
4 SASI_Rn01_00080232 predicted 585
5 SASI_Rn01_00080234 predicted 644
6 SASI_Rn01_00080235 predicted 290
7 SASI_Rn01_00080236 predicted 986
8 SASI_Rn01_00080237 predicted 675
9 SASI_Rn01_00080238 predicted 245
10 SASI_Rn02_00265482 predicted 517
11 SASI_Rn01_00080233 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107400 predicted 820
2 SASI_Mm01_00107401 predicted 1004
3 SASI_Mm01_00107402 predicted 923
4 SASI_Mm01_00107404 predicted 962
5 SASI_Mm01_00107405 predicted 1078
6 SASI_Mm01_00107406 predicted 549
7 SASI_Mm01_00107407 predicted 656
8 SASI_Mm01_00107408 predicted 606
9 SASI_Mm02_00326858 predicted 621
10 SASI_Mm02_00326859 predicted 759
11 SASI_Mm01_00107399 predicted 663
12 SASI_Mm01_00107403 predicted 536
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006541
VALIDATED
GLRX3 MISSION shRNA Bacterial Glycerol Stock
glutaredoxin 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006541.1-184s1c1
Sequence:CCGGCCCTCAAGTTTCATTTGTGAACTCGAGTTCACAAATGAAACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006541.1-751s1c1
Sequence:CCGGGCTCTTTATGAAAGGAAACAACTCGAGTTGTTTCCTTTCATAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006541.1-372s1c1
Sequence:CCGGCCAGCGCTAATGAACATCTTACTCGAGTAAGATGTTCATTAGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006541.1-151s1c1
Sequence:CCGGGAACGAAGTTATGGCAGAGTTCTCGAGAACTCTGCCATAACTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006541.1-596s1c1
Sequence:CCGGCCTACCTATCCTCAGCTCTATCTCGAGATAGAGCTGAGGATAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006541
VALIDATED
GLRX3 MISSION shRNA shRNA Plasmid DNA
glutaredoxin 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006541.1-184s1c1
Sequence:CCGGCCCTCAAGTTTCATTTGTGAACTCGAGTTCACAAATGAAACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006541.1-751s1c1
Sequence:CCGGGCTCTTTATGAAAGGAAACAACTCGAGTTGTTTCCTTTCATAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006541.1-372s1c1
Sequence:CCGGCCAGCGCTAATGAACATCTTACTCGAGTAAGATGTTCATTAGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006541.1-151s1c1
Sequence:CCGGGAACGAAGTTATGGCAGAGTTCTCGAGAACTCTGCCATAACTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006541.1-596s1c1
Sequence:CCGGCCTACCTATCCTCAGCTCTATCTCGAGATAGAGCTGAGGATAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006541
VALIDATED
GLRX3 MISSION shRNA Lentiviral Transduction Particles
glutaredoxin 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006541.1-184s1c1
Sequence:CCGGCCCTCAAGTTTCATTTGTGAACTCGAGTTCACAAATGAAACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006541.1-751s1c1
Sequence:CCGGGCTCTTTATGAAAGGAAACAACTCGAGTTGTTTCCTTTCATAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006541.1-372s1c1
Sequence:CCGGCCAGCGCTAATGAACATCTTACTCGAGTAAGATGTTCATTAGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006541.1-151s1c1
Sequence:CCGGGAACGAAGTTATGGCAGAGTTCTCGAGAACTCTGCCATAACTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006541.1-596s1c1
Sequence:CCGGCCTACCTATCCTCAGCTCTATCTCGAGATAGAGCTGAGGATAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023140
VALIDATED
GLRX3 MISSION shRNA Bacterial Glycerol Stock
glutaredoxin 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023140.3-1310s1c1
Sequence:CCGGCGCTGTCACTAATTCCTTTAACTCGAGTTAAAGGAATTAGTGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023140.3-202s1c1
Sequence:CCGGGCTAAAGAACACCCTCATGTTCTCGAGAACATGAGGGTGTTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023140.3-242s1c1
Sequence:CCGGCCGAAGCTGTTCCTGAAGTATCTCGAGATACTTCAGGAACAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023140.3-612s1c1
Sequence:CCGGGTACTCTAATTGGCCCACCTACTCGAGTAGGTGGGCCAATTAGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023140.3-821s1c1
Sequence:CCGGTCAGCAAACAAATTCTGGAAACTCGAGTTTCCAGAATTTGTTTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023140.4-201s21c1
Sequence:CCGGGCTAAAGAACACCCTCATGTTCTCGAGAACATGAGGGTGTTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023140.4-1408s21c1
Sequence:CCGGACTCCTGTACCAGTCCAATAGCTCGAGCTATTGGACTGGTACAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023140.4-820s21c1
Sequence:CCGGTCAGCAAACAAATTCTGGAAACTCGAGTTTCCAGAATTTGTTTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023140.4-241s21c1
Sequence:CCGGCCGAAGCTGTTCCTGAAGTATCTCGAGATACTTCAGGAACAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023140
VALIDATED
GLRX3 MISSION shRNA shRNA Plasmid DNA
glutaredoxin 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023140.3-1310s1c1
Sequence:CCGGCGCTGTCACTAATTCCTTTAACTCGAGTTAAAGGAATTAGTGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023140.3-202s1c1
Sequence:CCGGGCTAAAGAACACCCTCATGTTCTCGAGAACATGAGGGTGTTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023140.3-242s1c1
Sequence:CCGGCCGAAGCTGTTCCTGAAGTATCTCGAGATACTTCAGGAACAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023140.3-612s1c1
Sequence:CCGGGTACTCTAATTGGCCCACCTACTCGAGTAGGTGGGCCAATTAGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023140.3-821s1c1
Sequence:CCGGTCAGCAAACAAATTCTGGAAACTCGAGTTTCCAGAATTTGTTTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023140.4-201s21c1
Sequence:CCGGGCTAAAGAACACCCTCATGTTCTCGAGAACATGAGGGTGTTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023140.4-1408s21c1
Sequence:CCGGACTCCTGTACCAGTCCAATAGCTCGAGCTATTGGACTGGTACAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023140.4-820s21c1
Sequence:CCGGTCAGCAAACAAATTCTGGAAACTCGAGTTTCCAGAATTTGTTTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023140.4-241s21c1
Sequence:CCGGCCGAAGCTGTTCCTGAAGTATCTCGAGATACTTCAGGAACAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023140
VALIDATED
GLRX3 MISSION shRNA Lentiviral Transduction Particles
glutaredoxin 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023140.3-1310s1c1
Sequence:CCGGCGCTGTCACTAATTCCTTTAACTCGAGTTAAAGGAATTAGTGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023140.3-202s1c1
Sequence:CCGGGCTAAAGAACACCCTCATGTTCTCGAGAACATGAGGGTGTTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023140.3-242s1c1
Sequence:CCGGCCGAAGCTGTTCCTGAAGTATCTCGAGATACTTCAGGAACAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023140.3-612s1c1
Sequence:CCGGGTACTCTAATTGGCCCACCTACTCGAGTAGGTGGGCCAATTAGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023140.3-821s1c1
Sequence:CCGGTCAGCAAACAAATTCTGGAAACTCGAGTTTCCAGAATTTGTTTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023140.4-201s21c1
Sequence:CCGGGCTAAAGAACACCCTCATGTTCTCGAGAACATGAGGGTGTTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023140.4-1408s21c1
Sequence:CCGGACTCCTGTACCAGTCCAATAGCTCGAGCTATTGGACTGGTACAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023140.4-820s21c1
Sequence:CCGGTCAGCAAACAAATTCTGGAAACTCGAGTTTCCAGAATTTGTTTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023140.4-241s21c1
Sequence:CCGGCCGAAGCTGTTCCTGAAGTATCTCGAGATACTTCAGGAACAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks