EMAIL THIS PAGE TO A FRIEND

GLRX5

glutaredoxin 5

51 Gene Product Result for
Synonyms: C14orf87 FLB4739 GRX5 PR01238 PRO1238
UniProtKB ID: Q86SX6, Q0X088, Q3YML0, Q86WY3, Q8IZ54
Gene ID:
Human(51218) Summary: This gene encodes a mitochondrial protein, which is evolutionarily conserved. It is involved in the biogenesis of iron-sulfur clusters, which are required for normal iron homeostasis. Mutations in this gene are associated with autosomal recessive pyridoxine-refractory sideroblastic anemia. [provided by RefSeq, May 2010]
Mouse(73046) glutaredoxin 5 homolog (S. cerevisiae)
Rat(362776) glutaredoxin 5
Zebrafish(406294) glutaredoxin 5 homolog (S. cerevisiae)
cow(505935) glutaredoxin 5
domestic cat(101082415) glutaredoxin 5
dog(612417) glutaredoxin 5
chicken(423440) glutaredoxin 5
naked mole-rat(101722704) glutaredoxin 5
sheep(101120526) glutaredoxin 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016417 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016417 Rosetta Predictions human pricing
NM_001108722 Rosetta Predictions rat pricing
NM_028419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045918 predicted 795
2 SASI_Hs01_00045923 predicted 848
3 SASI_Hs01_00045924 predicted 847
4 SASI_Hs01_00045926 predicted 914
5 SASI_Hs02_00349443 predicted 824
6 SASI_Hs01_00045919 predicted 726
7 SASI_Hs02_00349444 predicted 905
8 SASI_Hs01_00045920 predicted 799
9 SASI_Hs01_00045921 predicted 673
10 SASI_Hs02_00349445 predicted 459
11 SASI_Hs01_00045922 predicted 436
12 SASI_Hs01_00045925 predicted 737
13 SASI_Hs01_00045927 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108722 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241435 predicted 266
2 SASI_Rn02_00241436 predicted 371
3 SASI_Rn02_00241437 predicted 442
4 SASI_Rn02_00241438 predicted 334
5 SASI_Rn02_00241439 predicted 353
6 SASI_Rn02_00241440 predicted 307
7 SASI_Rn02_00241441 predicted 896
8 SASI_Rn02_00241442 predicted 758
9 SASI_Rn02_00241443 predicted 661
10 SASI_Rn02_00241444 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107851 predicted 629
2 SASI_Mm01_00107852 predicted 358
3 SASI_Mm01_00107853 predicted 311
4 SASI_Mm01_00107854 predicted 684
5 SASI_Mm01_00107855 predicted 688
6 SASI_Mm01_00107856 predicted 689
7 SASI_Mm01_00107857 predicted 285
8 SASI_Mm01_00107858 predicted 672
9 SASI_Mm01_00107859 predicted 668
10 SASI_Mm01_00107860 predicted 315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016417
VALIDATED
GLRX5 MISSION shRNA Bacterial Glycerol Stock
glutaredoxin 5
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016417.2-439s21c1
Sequence:CCGGTGTACCTCAATGGCGAGTTTGCTCGAGCAAACTCGCCATTGAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016417.2-702s21c1
Sequence:CCGGTTCGTGAGCAGTTGGTGATTTCTCGAGAAATCACCAACTGCTCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016417.2-500s21c1
Sequence:CCGGGGACTTGGTGGAAGAACTGAACTCGAGTTCAGTTCTTCCACCAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016417.2-557s21c1
Sequence:CCGGGAAAGACCAAGACTCCAAGTGCTCGAGCACTTGGAGTCTTGGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016417.2-841s1c1
Sequence:CCGGGTCACTTATTCTTTGCCTGATCTCGAGATCAGGCAAAGAATAAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183832    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016417.2-863s1c1
Sequence:CCGGCAGAAGTTAAATAGGAGCTTTCTCGAGAAAGCTCCTATTTAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016417
VALIDATED
GLRX5 MISSION shRNA shRNA Plasmid DNA
glutaredoxin 5
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016417.2-439s21c1
Sequence:CCGGTGTACCTCAATGGCGAGTTTGCTCGAGCAAACTCGCCATTGAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016417.2-702s21c1
Sequence:CCGGTTCGTGAGCAGTTGGTGATTTCTCGAGAAATCACCAACTGCTCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016417.2-500s21c1
Sequence:CCGGGGACTTGGTGGAAGAACTGAACTCGAGTTCAGTTCTTCCACCAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016417.2-557s21c1
Sequence:CCGGGAAAGACCAAGACTCCAAGTGCTCGAGCACTTGGAGTCTTGGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016417.2-841s1c1
Sequence:CCGGGTCACTTATTCTTTGCCTGATCTCGAGATCAGGCAAAGAATAAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183832    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016417.2-863s1c1
Sequence:CCGGCAGAAGTTAAATAGGAGCTTTCTCGAGAAAGCTCCTATTTAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016417
VALIDATED
GLRX5 MISSION shRNA Lentiviral Transduction Particles
glutaredoxin 5
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016417.2-439s21c1
Sequence:CCGGTGTACCTCAATGGCGAGTTTGCTCGAGCAAACTCGCCATTGAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016417.2-702s21c1
Sequence:CCGGTTCGTGAGCAGTTGGTGATTTCTCGAGAAATCACCAACTGCTCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016417.2-500s21c1
Sequence:CCGGGGACTTGGTGGAAGAACTGAACTCGAGTTCAGTTCTTCCACCAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016417.2-557s21c1
Sequence:CCGGGAAAGACCAAGACTCCAAGTGCTCGAGCACTTGGAGTCTTGGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016417.2-841s1c1
Sequence:CCGGGTCACTTATTCTTTGCCTGATCTCGAGATCAGGCAAAGAATAAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183832    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016417.2-863s1c1
Sequence:CCGGCAGAAGTTAAATAGGAGCTTTCTCGAGAAAGCTCCTATTTAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028419
VALIDATED
GLRX5 MISSION shRNA Bacterial Glycerol Stock
glutaredoxin 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028419.1-666s1c1
Sequence:CCGGCGCGATCCTGTATTGCTATAACTCGAGTTATAGCAATACAGGATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028419.1-397s1c1
Sequence:CCGGGACCTAGTGGAAGAACTGAAACTCGAGTTTCAGTTCTTCCACTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028419.1-372s1c1
Sequence:CCGGCCTTCTGCAGATGCATCAGAACTCGAGTTCTGATGCATCTGCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028419.1-138s1c1
Sequence:CCGGCGCGCTGGTGAAGAAGGACAACTCGAGTTGTCCTTCTTCACCAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028419.1-288s1c1
Sequence:CCGGGAGGCAAGGTATTAAAGACTACTCGAGTAGTCTTTAATACCTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028419
VALIDATED
GLRX5 MISSION shRNA shRNA Plasmid DNA
glutaredoxin 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028419.1-666s1c1
Sequence:CCGGCGCGATCCTGTATTGCTATAACTCGAGTTATAGCAATACAGGATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028419.1-397s1c1
Sequence:CCGGGACCTAGTGGAAGAACTGAAACTCGAGTTTCAGTTCTTCCACTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028419.1-372s1c1
Sequence:CCGGCCTTCTGCAGATGCATCAGAACTCGAGTTCTGATGCATCTGCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028419.1-138s1c1
Sequence:CCGGCGCGCTGGTGAAGAAGGACAACTCGAGTTGTCCTTCTTCACCAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028419.1-288s1c1
Sequence:CCGGGAGGCAAGGTATTAAAGACTACTCGAGTAGTCTTTAATACCTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028419
VALIDATED
GLRX5 MISSION shRNA Lentiviral Transduction Particles
glutaredoxin 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028419.1-666s1c1
Sequence:CCGGCGCGATCCTGTATTGCTATAACTCGAGTTATAGCAATACAGGATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028419.1-397s1c1
Sequence:CCGGGACCTAGTGGAAGAACTGAAACTCGAGTTTCAGTTCTTCCACTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028419.1-372s1c1
Sequence:CCGGCCTTCTGCAGATGCATCAGAACTCGAGTTCTGATGCATCTGCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028419.1-138s1c1
Sequence:CCGGCGCGCTGGTGAAGAAGGACAACTCGAGTTGTCCTTCTTCACCAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028419.1-288s1c1
Sequence:CCGGGAGGCAAGGTATTAAAGACTACTCGAGTAGTCTTTAATACCTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks