EMAIL THIS PAGE TO A FRIEND

GLRX

glutaredoxin (thioltransferase)

67 Gene Product Result for
Synonyms: GRX GRX1
UniProtKB ID: P35754, B2R4L2, Q3KQS1, Q6ICT1
Gene ID:
Human(2745) Summary: This gene encodes a member of the glutaredoxin family. The encoded protein is a cytoplasmic enzyme catalyzing the reversible reduction of glutathione-protein mixed disulfides. This enzyme highly contributes to the antioxidant defense system. It is crucial for several signalling pathways by controlling the S-glutathionylation status of signalling mediators. It is involved in beta-amyloid toxicity and Alzheimer's disease. Multiple alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Aug 2011]
Mouse(93692) glutaredoxin
Rat(64045) glutaredoxin (thioltransferase)
sheep(100147797) glutaredoxin (thioltransferase)
domestic guinea pig(100713710) glutaredoxin (thioltransferase)
naked mole-rat(101701791) glutaredoxin (thioltransferase)
Zebrafish(449769) glutaredoxin (thioltransferase)
cow(515416) glutaredoxin (thioltransferase)
domestic cat(101081864) glutaredoxin (thioltransferase)
dog(609246) glutaredoxin (thioltransferase)
chicken(396069) glutaredoxin (thioltransferase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053108 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053108 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053108 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002064 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002064 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002064 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU007471 MISSION® esiRNA esiRNA targeting mouse Glrx (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001118890 Rosetta Predictions human pricing
NM_002064 Rosetta Predictions human pricing
NM_022278 Rosetta Predictions rat pricing
NM_053108 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001118890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327040 predicted 302
2 SASI_Hs02_00327041 predicted 300
3 SASI_Hs02_00327042 predicted 310
4 SASI_Hs02_00327043 predicted 265
5 SASI_Hs02_00327044 predicted 301
6 SASI_Hs02_00327045 predicted 296
7 SASI_Hs02_00327046 predicted 301
8 SASI_Hs02_00327047 predicted 695
9 SASI_Hs02_00327048 predicted 517
10 SASI_Hs02_00327049 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333125 predicted 304
2 SASI_Hs02_00333126 predicted 307
3 SASI_Hs02_00333127 predicted 303
4 SASI_Hs02_00333128 predicted 269
5 SASI_Hs02_00333129 predicted 306
6 SASI_Hs02_00333130 predicted 299
7 SASI_Hs02_00333131 predicted 307
8 SASI_Hs02_00333132 predicted 667
9 SASI_Hs02_00333133 predicted 806
10 SASI_Hs01_00232891 predicted 898
11 SASI_Hs01_00232885 predicted 588
12 SASI_Hs01_00232886 predicted 261
13 SASI_Hs01_00232887 predicted 224
14 SASI_Hs01_00232888 predicted 730
15 SASI_Hs01_00232889 predicted 684
16 SASI_Hs01_00232890 predicted 313
17 SASI_Hs01_00232892 predicted 765
18 SASI_Hs01_00232893 predicted 269
19 SASI_Hs01_00232894 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108522 predicted 272
2 SASI_Rn01_00108523 predicted 699
3 SASI_Rn01_00108524 predicted 713
4 SASI_Rn01_00108525 predicted 588
5 SASI_Rn01_00108526 predicted 739
6 SASI_Rn01_00108527 predicted 254
7 SASI_Rn01_00108528 predicted 302
8 SASI_Rn01_00108529 predicted 277
9 SASI_Rn01_00108530 predicted 556
10 SASI_Rn01_00108531 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053108 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168181 predicted 701
2 SASI_Mm01_00168182 predicted 322
3 SASI_Mm01_00168183 predicted 759
4 SASI_Mm01_00168184 predicted 383
5 SASI_Mm01_00168185 predicted 605
6 SASI_Mm01_00168186 predicted 681
7 SASI_Mm01_00168187 predicted 643
8 SASI_Mm01_00168188 predicted 850
9 SASI_Mm01_00168189 predicted 480
10 SASI_Mm01_00168190 predicted 614
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053108
VALIDATED
GLRX MISSION shRNA Bacterial Glycerol Stock
glutaredoxin (thioltransferase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053108.2-221s1c1
Sequence:CCGGCCAGTGCGATTCAAGATTATTCTCGAGAATAATCTTGAATCGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053108.2-156s1c1
Sequence:CCGGCCTCAGTCAACTGCCTTTCAACTCGAGTTGAAAGGCAGTTGACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053108.2-300s1c1
Sequence:CCGGAGGCGGATGCAGTGATCTAATCTCGAGATTAGATCACTGCATCCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053108.2-271s1c1
Sequence:CCGGCCTCGGGTCTTCATAGGTAAACTCGAGTTTACCTATGAAGACCCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053108.2-145s1c1
Sequence:CCGGACCCAAGAAATCCTCAGTCAACTCGAGTTGACTGAGGATTTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053108.4-486s21c1
Sequence:CCGGATCGCAGAGGATGTCAGTATTCTCGAGAATACTGACATCCTCTGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053108.4-388s21c1
Sequence:CCGGTTGGAGCTCTGCAGTTATAAACTCGAGTTTATAACTGCAGAGCTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053108.4-295s21c1
Sequence:CCGGCTCGGGTCTTCATAGGTAAAGCTCGAGCTTTACCTATGAAGACCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053108.4-323s21c1
Sequence:CCGGAGGCGGATGCAGTGATCTAATCTCGAGATTAGATCACTGCATCCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053108.4-244s21c1
Sequence:CCGGCCAGTGCGATTCAAGATTATTCTCGAGAATAATCTTGAATCGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053108
VALIDATED
GLRX MISSION shRNA shRNA Plasmid DNA
glutaredoxin (thioltransferase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053108.2-221s1c1
Sequence:CCGGCCAGTGCGATTCAAGATTATTCTCGAGAATAATCTTGAATCGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053108.2-156s1c1
Sequence:CCGGCCTCAGTCAACTGCCTTTCAACTCGAGTTGAAAGGCAGTTGACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053108.2-300s1c1
Sequence:CCGGAGGCGGATGCAGTGATCTAATCTCGAGATTAGATCACTGCATCCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053108.2-271s1c1
Sequence:CCGGCCTCGGGTCTTCATAGGTAAACTCGAGTTTACCTATGAAGACCCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053108.2-145s1c1
Sequence:CCGGACCCAAGAAATCCTCAGTCAACTCGAGTTGACTGAGGATTTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053108.4-486s21c1
Sequence:CCGGATCGCAGAGGATGTCAGTATTCTCGAGAATACTGACATCCTCTGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053108.4-388s21c1
Sequence:CCGGTTGGAGCTCTGCAGTTATAAACTCGAGTTTATAACTGCAGAGCTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053108.4-295s21c1
Sequence:CCGGCTCGGGTCTTCATAGGTAAAGCTCGAGCTTTACCTATGAAGACCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053108.4-323s21c1
Sequence:CCGGAGGCGGATGCAGTGATCTAATCTCGAGATTAGATCACTGCATCCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053108.4-244s21c1
Sequence:CCGGCCAGTGCGATTCAAGATTATTCTCGAGAATAATCTTGAATCGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053108
VALIDATED
GLRX MISSION shRNA Lentiviral Transduction Particles
glutaredoxin (thioltransferase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053108.2-221s1c1
Sequence:CCGGCCAGTGCGATTCAAGATTATTCTCGAGAATAATCTTGAATCGCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053108.2-156s1c1
Sequence:CCGGCCTCAGTCAACTGCCTTTCAACTCGAGTTGAAAGGCAGTTGACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053108.2-300s1c1
Sequence:CCGGAGGCGGATGCAGTGATCTAATCTCGAGATTAGATCACTGCATCCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053108.2-271s1c1
Sequence:CCGGCCTCGGGTCTTCATAGGTAAACTCGAGTTTACCTATGAAGACCCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053108.2-145s1c1
Sequence:CCGGACCCAAGAAATCCTCAGTCAACTCGAGTTGACTGAGGATTTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053108.4-486s21c1
Sequence:CCGGATCGCAGAGGATGTCAGTATTCTCGAGAATACTGACATCCTCTGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053108.4-388s21c1
Sequence:CCGGTTGGAGCTCTGCAGTTATAAACTCGAGTTTATAACTGCAGAGCTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053108.4-295s21c1
Sequence:CCGGCTCGGGTCTTCATAGGTAAAGCTCGAGCTTTACCTATGAAGACCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053108.4-323s21c1
Sequence:CCGGAGGCGGATGCAGTGATCTAATCTCGAGATTAGATCACTGCATCCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053108.4-244s21c1
Sequence:CCGGCCAGTGCGATTCAAGATTATTCTCGAGAATAATCTTGAATCGCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002064
VALIDATED
GLRX MISSION shRNA Bacterial Glycerol Stock
glutaredoxin (thioltransferase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002064.1-111s1c1
Sequence:CCGGCCTCAGTCAATTGCCCATCAACTCGAGTTGATGGGCAATTGACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002064.1-172s1c1
Sequence:CCGGCACACTAACGAGATTCAAGATCTCGAGATCTTGAATCTCGTTAGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002064.1-242s1c1
Sequence:CCGGGTAAAGATTGTATAGGCGGATCTCGAGATCCGCCTATACAATCTTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002064.1-260s1c1
Sequence:CCGGGATGCAGTGATCTAGTCTCTTCTCGAGAAGAGACTAGATCACTGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002064.1-229s1c1
Sequence:CCGGCGAGTCTTTATTGGTAAAGATCTCGAGATCTTTACCAATAAAGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002064.2-775s21c1
Sequence:CCGGTTCGCTCACTGACCCTCAATTCTCGAGAATTGAGGGTCAGTGAGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002064.2-393s21c1
Sequence:CCGGTGCAACAGCTCACGGGAGCAACTCGAGTTGCTCCCGTGAGCTGTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002064.2-456s21c1
Sequence:CCGGGATGCAGTGATCTAGTCTCTTCTCGAGAAGAGACTAGATCACTGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_002064.2-307s21c1
Sequence:CCGGCCTCAGTCAATTGCCCATCAACTCGAGTTGATGGGCAATTGACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_002064.2-517s21c1
Sequence:CCGGTGGAGCTCTGCAGTAACCACACTCGAGTGTGGTTACTGCAGAGCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002064
VALIDATED
GLRX MISSION shRNA shRNA Plasmid DNA
glutaredoxin (thioltransferase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002064.1-111s1c1
Sequence:CCGGCCTCAGTCAATTGCCCATCAACTCGAGTTGATGGGCAATTGACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002064.1-172s1c1
Sequence:CCGGCACACTAACGAGATTCAAGATCTCGAGATCTTGAATCTCGTTAGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002064.1-242s1c1
Sequence:CCGGGTAAAGATTGTATAGGCGGATCTCGAGATCCGCCTATACAATCTTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002064.1-260s1c1
Sequence:CCGGGATGCAGTGATCTAGTCTCTTCTCGAGAAGAGACTAGATCACTGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002064.1-229s1c1
Sequence:CCGGCGAGTCTTTATTGGTAAAGATCTCGAGATCTTTACCAATAAAGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002064.2-775s21c1
Sequence:CCGGTTCGCTCACTGACCCTCAATTCTCGAGAATTGAGGGTCAGTGAGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002064.2-393s21c1
Sequence:CCGGTGCAACAGCTCACGGGAGCAACTCGAGTTGCTCCCGTGAGCTGTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002064.2-456s21c1
Sequence:CCGGGATGCAGTGATCTAGTCTCTTCTCGAGAAGAGACTAGATCACTGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_002064.2-307s21c1
Sequence:CCGGCCTCAGTCAATTGCCCATCAACTCGAGTTGATGGGCAATTGACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_002064.2-517s21c1
Sequence:CCGGTGGAGCTCTGCAGTAACCACACTCGAGTGTGGTTACTGCAGAGCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002064
VALIDATED
GLRX MISSION shRNA Lentiviral Transduction Particles
glutaredoxin (thioltransferase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002064.1-111s1c1
Sequence:CCGGCCTCAGTCAATTGCCCATCAACTCGAGTTGATGGGCAATTGACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002064.1-172s1c1
Sequence:CCGGCACACTAACGAGATTCAAGATCTCGAGATCTTGAATCTCGTTAGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002064.1-242s1c1
Sequence:CCGGGTAAAGATTGTATAGGCGGATCTCGAGATCCGCCTATACAATCTTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002064.1-260s1c1
Sequence:CCGGGATGCAGTGATCTAGTCTCTTCTCGAGAAGAGACTAGATCACTGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002064.1-229s1c1
Sequence:CCGGCGAGTCTTTATTGGTAAAGATCTCGAGATCTTTACCAATAAAGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002064.2-775s21c1
Sequence:CCGGTTCGCTCACTGACCCTCAATTCTCGAGAATTGAGGGTCAGTGAGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002064.2-393s21c1
Sequence:CCGGTGCAACAGCTCACGGGAGCAACTCGAGTTGCTCCCGTGAGCTGTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002064.2-456s21c1
Sequence:CCGGGATGCAGTGATCTAGTCTCTTCTCGAGAAGAGACTAGATCACTGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_002064.2-307s21c1
Sequence:CCGGCCTCAGTCAATTGCCCATCAACTCGAGTTGATGGGCAATTGACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_002064.2-517s21c1
Sequence:CCGGTGGAGCTCTGCAGTAACCACACTCGAGTGTGGTTACTGCAGAGCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)