EMAIL THIS PAGE TO A FRIEND

GLRXP3

glutaredoxin (thioltransferase) pseudogene 3

Synonyms: GLRXL
Species: Human GLRXP3(100132510)
Gene ID:
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001123388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001123388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001123388 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147051 MISSION® esiRNA esiRNA human GLRXP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123388 Rosetta Predictions human pricing
XM_001722858 Rosetta Predictions human pricing
XM_001725190 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327906 predicted 143
2 SASI_Hs02_00327907 predicted 98
3 SASI_Hs02_00327908 predicted 143
4 SASI_Hs02_00327909 predicted 193
5 SASI_Hs02_00327910 predicted 93
6 SASI_Hs02_00327911 predicted 95
7 SASI_Hs02_00327912 predicted 190
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00451757 predicted 148
2 SASI_Hs02_00451758 predicted 94
3 SASI_Hs02_00451759 predicted 141
4 SASI_Hs02_00451760 predicted 195
5 SASI_Hs02_00451761 predicted 88
6 SASI_Hs02_00451762 predicted 100
7 SASI_Hs02_00451763 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00466145 predicted 146
2 SASI_Hs02_00466146 predicted 97
3 SASI_Hs02_00466147 predicted 149
4 SASI_Hs02_00466148 predicted 198
5 SASI_Hs02_00466149 predicted 95
6 SASI_Hs02_00466150 predicted 97
7 SASI_Hs02_00466151 predicted 196
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123388
GLRXP3 MISSION shRNA Bacterial Glycerol Stock
glutaredoxin (thioltransferase) pseudogene 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123388.1-87s21c1
Sequence:CCGGCCAAGAGATCCTCAGTCAATTCTCGAGAATTGACTGAGGATCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123388.1-53s21c1
Sequence:CCGGTCATCAAGCCCACCTGTCCATCTCGAGATGGACAGGTGGGCTTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123388.1-123s21c1
Sequence:CCGGGCTTCTGGAATTTGTCGATATCTCGAGATATCGACAAATTCCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123388.1-147s21c1
Sequence:CCGGAGCCTCCAACCACACTAACAACTCGAGTTGTTAGTGTGGTTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123388.1-101s21c1
Sequence:CCGGGTCAATTGTCCACCAAACAAACTCGAGTTTGTTTGGTGGACAATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123388
GLRXP3 MISSION shRNA shRNA Plasmid DNA
glutaredoxin (thioltransferase) pseudogene 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123388.1-87s21c1
Sequence:CCGGCCAAGAGATCCTCAGTCAATTCTCGAGAATTGACTGAGGATCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123388.1-53s21c1
Sequence:CCGGTCATCAAGCCCACCTGTCCATCTCGAGATGGACAGGTGGGCTTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123388.1-123s21c1
Sequence:CCGGGCTTCTGGAATTTGTCGATATCTCGAGATATCGACAAATTCCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123388.1-147s21c1
Sequence:CCGGAGCCTCCAACCACACTAACAACTCGAGTTGTTAGTGTGGTTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123388.1-101s21c1
Sequence:CCGGGTCAATTGTCCACCAAACAAACTCGAGTTTGTTTGGTGGACAATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123388
GLRXP3 MISSION shRNA Lentiviral Transduction Particles
glutaredoxin (thioltransferase) pseudogene 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123388.1-87s21c1
Sequence:CCGGCCAAGAGATCCTCAGTCAATTCTCGAGAATTGACTGAGGATCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123388.1-53s21c1
Sequence:CCGGTCATCAAGCCCACCTGTCCATCTCGAGATGGACAGGTGGGCTTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123388.1-123s21c1
Sequence:CCGGGCTTCTGGAATTTGTCGATATCTCGAGATATCGACAAATTCCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123388.1-147s21c1
Sequence:CCGGAGCCTCCAACCACACTAACAACTCGAGTTGTTAGTGTGGTTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123388.1-101s21c1
Sequence:CCGGGTCAATTGTCCACCAAACAAACTCGAGTTTGTTTGGTGGACAATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks