EMAIL THIS PAGE TO A FRIEND

GLS2

glutaminase 2 (liver, mitochondrial)

238 Gene Product Result for
Synonyms: GA GLS LGA hLGA
UniProtKB ID: Q9UI32, Q8IX91, Q9NYY2, Q9UI31
Gene ID:
Human(27165) Summary: The protein encoded by this gene is a mitochondrial phosphate-activated glutaminase that catalyzes the hydrolysis of glutamine to stoichiometric amounts of glutamate and ammonia. This protein is functionally similar to the kidney glutaminase but is a little smaller in size. Originally thought to be liver-specific, this protein has been found in other tissues as well. At least one transcribed pseudogene has been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(216456) glutaminase 2 (liver, mitochondrial)
Rat(192268) glutaminase 2 (liver, mitochondrial)
Zebrafish(100006303) glutaminase 2 (liver, mitochondrial)
cow(539561) glutaminase 2 (liver, mitochondrial)
Horse(100059765) glutaminase 2 (liver, mitochondrial)
domestic cat(101100228) glutaminase 2 (liver, mitochondrial)
dog(100686499) glutaminase 2 (liver, mitochondrial)
domestic guinea pig(100718885) glutaminase 2 (liver, mitochondrial)
naked mole-rat(101705236) glutaminase 2 (liver, mitochondrial)
sheep(101107269) glutaminase 2 (liver, mitochondrial)
Domestic Rabbit(100352572) glutaminase 2 (liver, mitochondrial)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108573 Anti-GLS2 IgG fraction of antiserum pig, mouse, human, rat, bovine, rabbit, zebrafish, human, horse, guinea pig
immunohistochemistry, western blot pricing
SAB1307110 ANTI-GLS2 (C-TERM E513) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
AV43562 Anti-GLS2 antibody produced in rabbit IgG fraction of antiserum canine, guinea pig, pig, human, horse, mouse, bovine, zebrafish, rat, rabbit
immunohistochemistry, western blot pricing
HPA038608 Anti-GLS2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunohistochemistry, western blot pricing
SAB3500720 Anti-GLS2 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013267 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033264 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033264 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033264 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013267 Rosetta Predictions human pricing
NM_138566 Rosetta Predictions human pricing
NM_138904 Rosetta Predictions rat pricing
NM_001033264 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344495 predicted 529
2 SASI_Hs02_00344496 predicted 1250
3 SASI_Hs02_00344497 predicted 1324
4 SASI_Hs02_00344498 predicted 773
5 SASI_Hs02_00344499 predicted 772
6 SASI_Hs01_00187027 predicted 448
7 SASI_Hs02_00344500 predicted 974
8 SASI_Hs01_00187028 predicted 1720
9 SASI_Hs02_00344501 predicted 1072
10 SASI_Hs01_00187031 predicted 1180
11 SASI_Hs01_00187029 predicted 1750
12 SASI_Hs01_00187030 predicted 1870
13 SASI_Hs01_00187032 predicted 1110
14 SASI_Hs01_00187033 predicted 1241
15 SASI_Hs01_00187034 predicted 1073
16 SASI_Hs01_00187035 predicted 1340
17 SASI_Hs01_00187036 predicted 2142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123109 predicted 1207
2 SASI_Hs01_00123110 predicted 455
3 SASI_Hs01_00123111 predicted 461
4 SASI_Hs01_00123112 predicted 1075
5 SASI_Hs01_00123113 predicted 1058
6 SASI_Hs01_00123114 predicted 979
7 SASI_Hs01_00123115 predicted 980
8 SASI_Hs01_00123116 predicted 1106
9 SASI_Hs01_00123117 predicted 943
10 SASI_Hs01_00123118 predicted 1299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138904 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056934 predicted 580
2 SASI_Rn01_00056935 predicted 1542
3 SASI_Rn01_00056936 predicted 1518
4 SASI_Rn01_00056937 predicted 886
5 SASI_Rn01_00056938 predicted 910
6 SASI_Rn01_00056939 predicted 1388
7 SASI_Rn01_00056940 predicted 763
8 SASI_Rn01_00056941 predicted 721
9 SASI_Rn01_00056942 predicted 1670
10 SASI_Rn01_00056943 predicted 1631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118925 predicted 734
2 SASI_Mm01_00118927 predicted 1474
3 SASI_Mm01_00118928 predicted 923
4 SASI_Mm01_00118929 predicted 1551
5 SASI_Mm02_00288437 predicted 1398
6 SASI_Mm01_00118930 predicted 1505
7 SASI_Mm01_00118931 predicted 1780
8 SASI_Mm01_00118933 predicted 213
9 SASI_Mm01_00118934 predicted 532
10 SASI_Mm02_00288438 predicted 860
11 SASI_Mm01_00118926 predicted 488
12 SASI_Mm01_00118932 predicted 1394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013267
GLS2 MISSION shRNA Bacterial Glycerol Stock
glutaminase 2 (liver, mitochondrial)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013267.2-775s1c1
Sequence:CCGGCGCATCTTTGAGGATGTCAAACTCGAGTTTGACATCCTCAAAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013267.2-1804s1c1
Sequence:CCGGGCCATGGATATGGAACAGAAACTCGAGTTTCTGTTCCATATCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013267.2-1237s1c1
Sequence:CCGGCGGAATTATGCCATCGGCTATCTCGAGATAGCCGATGGCATAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013267.2-1981s1c1
Sequence:CCGGGTGGTCAAACTGCTTCAAGATCTCGAGATCTTGAAGCAGTTTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013267.2-2053s1c1
Sequence:CCGGGCCCTGTCCAAAGAGAACTTACTCGAGTAAGTTCTCTTTGGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013267
GLS2 MISSION shRNA shRNA Plasmid DNA
glutaminase 2 (liver, mitochondrial)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013267.2-775s1c1
Sequence:CCGGCGCATCTTTGAGGATGTCAAACTCGAGTTTGACATCCTCAAAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013267.2-1804s1c1
Sequence:CCGGGCCATGGATATGGAACAGAAACTCGAGTTTCTGTTCCATATCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013267.2-1237s1c1
Sequence:CCGGCGGAATTATGCCATCGGCTATCTCGAGATAGCCGATGGCATAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013267.2-1981s1c1
Sequence:CCGGGTGGTCAAACTGCTTCAAGATCTCGAGATCTTGAAGCAGTTTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013267.2-2053s1c1
Sequence:CCGGGCCCTGTCCAAAGAGAACTTACTCGAGTAAGTTCTCTTTGGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013267
GLS2 MISSION shRNA Lentiviral Transduction Particles
glutaminase 2 (liver, mitochondrial)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013267.2-775s1c1
Sequence:CCGGCGCATCTTTGAGGATGTCAAACTCGAGTTTGACATCCTCAAAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013267.2-1804s1c1
Sequence:CCGGGCCATGGATATGGAACAGAAACTCGAGTTTCTGTTCCATATCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013267.2-1237s1c1
Sequence:CCGGCGGAATTATGCCATCGGCTATCTCGAGATAGCCGATGGCATAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013267.2-1981s1c1
Sequence:CCGGGTGGTCAAACTGCTTCAAGATCTCGAGATCTTGAAGCAGTTTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013267.2-2053s1c1
Sequence:CCGGGCCCTGTCCAAAGAGAACTTACTCGAGTAAGTTCTCTTTGGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033264
GLS2 MISSION shRNA Bacterial Glycerol Stock
glutaminase 2 (liver, mitochondrial)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000177991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033264.1-1501s1c1
Sequence:CCGGGAACCTGCTATTTGCTGCATACTCGAGTATGCAGCAAATAGCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033264.1-910s1c1
Sequence:CCGGGTTACAGTATCTGAACAAGATCTCGAGATCTTGTTCAGATACTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033264.1-799s1c1
Sequence:CCGGCTCCCTCAATGAGGAAGGAATCTCGAGATTCCTTCCTCATTGAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033264.1-2135s1c1
Sequence:CCGGCATCATGCCAACAAGCAACTTCTCGAGAAGTTGCTTGTTGGCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033264
GLS2 MISSION shRNA shRNA Plasmid DNA
glutaminase 2 (liver, mitochondrial)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000177991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033264.1-1501s1c1
Sequence:CCGGGAACCTGCTATTTGCTGCATACTCGAGTATGCAGCAAATAGCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033264.1-910s1c1
Sequence:CCGGGTTACAGTATCTGAACAAGATCTCGAGATCTTGTTCAGATACTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033264.1-799s1c1
Sequence:CCGGCTCCCTCAATGAGGAAGGAATCTCGAGATTCCTTCCTCATTGAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033264.1-2135s1c1
Sequence:CCGGCATCATGCCAACAAGCAACTTCTCGAGAAGTTGCTTGTTGGCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033264
GLS2 MISSION shRNA Lentiviral Transduction Particles
glutaminase 2 (liver, mitochondrial)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000177991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033264.1-1501s1c1
Sequence:CCGGGAACCTGCTATTTGCTGCATACTCGAGTATGCAGCAAATAGCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033264.1-910s1c1
Sequence:CCGGGTTACAGTATCTGAACAAGATCTCGAGATCTTGTTCAGATACTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033264.1-799s1c1
Sequence:CCGGCTCCCTCAATGAGGAAGGAATCTCGAGATTCCTTCCTCATTGAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033264.1-2135s1c1
Sequence:CCGGCATCATGCCAACAAGCAACTTCTCGAGAAGTTGCTTGTTGGCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks