EMAIL THIS PAGE TO A FRIEND

GLS

glutaminase

182 Gene Product Result for
Synonyms: AAD20 GAC GAM GLS1 KGA
UniProtKB ID: O94925, Q9UL05, Q9UL06, Q9UL07, Q9UN40
Gene ID:
Human(2744) Summary: This gene encodes the K-type mitochondrial glutaminase. The encoded protein is an phosphate-activated amidohydrolase that catalyzes the hydrolysis of glutamine to glutamate and ammonia. This protein is primarily expressed in the brain and kidney plays an essential role in generating energy for metabolism, synthesizing the brain neurotransmitter glutamate and maintaining acid-base balance in the kidney. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Mouse(14660) glutaminase
Rat(24398) glutaminase
chicken(424043) glutaminase
cow(525335) glutaminase
Horse(100069617) glutaminase
dog(488448) glutaminase
sheep(101122583) glutaminase
Gene Class: Amidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014905 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081081 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081081 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081081 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085901 MISSION® esiRNA esiRNA human GLS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014905 Rosetta Predictions human pricing
NM_001109968 Rosetta Predictions rat pricing
NM_012569 Rosetta Predictions rat pricing
NM_001081081 Rosetta Predictions mouse pricing
NM_001113383 Rosetta Predictions mouse pricing
XM_129846 Rosetta Predictions mouse pricing
XM_900171 Rosetta Predictions mouse pricing
XM_900176 Rosetta Predictions mouse pricing
XM_900189 Rosetta Predictions mouse pricing
XM_992184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071573 predicted 2255
2 SASI_Hs01_00071574 predicted 1072
3 SASI_Hs01_00071575 predicted 2237
4 SASI_Hs01_00071576 predicted 982
5 SASI_Hs02_00346542 predicted 780
6 SASI_Hs01_00071578 predicted 2208
7 SASI_Hs01_00071579 predicted 1584
8 SASI_Hs01_00071580 predicted 2005
9 SASI_Hs01_00071581 predicted 867
10 SASI_Hs01_00071582 predicted 1951
11 SASI_Hs01_00071577 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109968 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250922 predicted 1271
2 SASI_Rn02_00250923 predicted 568
3 SASI_Rn02_00250924 predicted 1318
4 SASI_Rn02_00250925 predicted 1423
5 SASI_Rn02_00250926 predicted 1187
6 SASI_Rn02_00250927 predicted 1076
7 SASI_Rn02_00250928 predicted 1095
8 SASI_Rn02_00250929 predicted 672
9 SASI_Rn02_00250930 predicted 747
10 SASI_Rn02_00250931 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012569 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114299 predicted 1274
2 SASI_Rn01_00114300 predicted 572
3 SASI_Rn01_00114302 predicted 1314
4 SASI_Rn02_00259684 predicted 1426
5 SASI_Rn01_00114306 predicted 1190
6 SASI_Rn01_00114307 predicted 1082
7 SASI_Rn02_00259685 predicted 1093
8 SASI_Rn02_00259686 predicted 668
9 SASI_Rn01_00114308 predicted 750
10 SASI_Rn02_00259687 predicted 760
11 SASI_Rn01_00114301 predicted 1223
12 SASI_Rn01_00114303 predicted 1867
13 SASI_Rn01_00114304 predicted 1725
14 SASI_Rn01_00114305 predicted 1641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294991 predicted 984
2 SASI_Mm02_00294992 predicted 1159
3 SASI_Mm02_00294993 predicted 757
4 SASI_Mm02_00294994 predicted 1065
5 SASI_Mm02_00294995 predicted 1375
6 SASI_Mm02_00294996 predicted 1463
7 SASI_Mm02_00294997 predicted 1612
8 SASI_Mm02_00294998 predicted 1399
9 SASI_Mm02_00294999 predicted 1263
10 SASI_Mm02_00295000 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307598 predicted 980
2 SASI_Mm02_00307599 predicted 1156
3 SASI_Mm02_00307600 predicted 756
4 SASI_Mm02_00307601 predicted 1065
5 SASI_Mm02_00307602 predicted 1377
6 SASI_Mm02_00307603 predicted 1465
7 SASI_Mm02_00307604 predicted 1608
8 SASI_Mm02_00307605 predicted 1399
9 SASI_Mm02_00307606 predicted 1271
10 SASI_Mm02_00307607 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244873 predicted 752
2 SASI_Mm01_00244874 predicted 923
3 SASI_Mm01_00244875 predicted 525
4 SASI_Mm01_00244876 predicted 1227
5 SASI_Mm01_00244877 predicted 1587
6 SASI_Mm01_00244878 predicted 1377
7 SASI_Mm01_00244879 predicted 1162
8 SASI_Mm01_00244880 predicted 1036
9 SASI_Mm01_00244881 predicted 706
10 SASI_Mm01_00244882 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229074 predicted 200
2 SASI_Mm01_00229075 predicted 199
3 SASI_Mm01_00229076 predicted 170
4 SASI_Mm01_00229077 predicted 134
5 SASI_Mm01_00229078 predicted 173
6 SASI_Mm01_00229079 predicted 134
7 SASI_Mm01_00229080 predicted 181
8 SASI_Mm01_00229081 predicted 117
9 SASI_Mm01_00229082 predicted 272
10 SASI_Mm01_00229083 predicted 157
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249052 predicted 2255
2 SASI_Mm01_00249053 predicted 2316
3 SASI_Mm01_00249054 predicted 2818
4 SASI_Mm01_00249055 predicted 2273
5 SASI_Mm01_00249056 predicted 2355
6 SASI_Mm01_00249057 predicted 2677
7 SASI_Mm01_00249058 predicted 2711
8 SASI_Mm01_00249059 predicted 2788
9 SASI_Mm01_00249060 predicted 2504
10 SASI_Mm01_00249061 predicted 2289
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242139 predicted 985
2 SASI_Mm01_00242140 predicted 1156
3 SASI_Mm01_00242141 predicted 761
4 SASI_Mm01_00242142 predicted 1070
5 SASI_Mm01_00242143 predicted 1464
6 SASI_Mm01_00242144 predicted 1821
7 SASI_Mm01_00242145 predicted 1893
8 SASI_Mm01_00242146 predicted 1611
9 SASI_Mm01_00242147 predicted 1395
10 SASI_Mm01_00242148 predicted 1269
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205918 predicted 380
2 SASI_Mm01_00205919 predicted 548
3 SASI_Mm01_00205920 predicted 462
4 SASI_Mm01_00205921 predicted 861
5 SASI_Mm01_00205922 predicted 1219
6 SASI_Mm01_00205923 predicted 1283
7 SASI_Mm01_00205924 predicted 1010
8 SASI_Mm01_00205925 predicted 790
9 SASI_Mm01_00205926 predicted 657
10 SASI_Mm01_00205927 predicted 338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014905
VALIDATED
GLS MISSION shRNA Bacterial Glycerol Stock
glutaminase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014905.3-2247s21c1
Sequence:CCGGCCATAAGAATCTTGATGGATTCTCGAGAATCCATCAAGATTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014905.3-1610s21c1
Sequence:CCGGGCCCTGAAGCAGTTCGAAATACTCGAGTATTTCGAACTGCTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014905.3-947s21c1
Sequence:CCGGCCTCACACATTGATGAGTTATCTCGAGATAACTCATCAATGTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014905.3-835s21c1
Sequence:CCGGGATGGTGTCATGCTAGACAAACTCGAGTTTGTCTAGCATGACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014905.3-1475s21c1
Sequence:CCGGGCACAGACATGGTTGGTATATCTCGAGATATACCAACCATGTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014905.2-801s1c1
Sequence:CCGGGATGGTGTCATGCTAGACAAACTCGAGTTTGTCTAGCATGACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014905.2-913s1c1
Sequence:CCGGCCTCACACATTGATGAGTTATCTCGAGATAACTCATCAATGTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014905.2-1441s1c1
Sequence:CCGGGCACAGACATGGTTGGTATATCTCGAGATATACCAACCATGTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014905.2-1576s1c1
Sequence:CCGGGCCCTGAAGCAGTTCGAAATACTCGAGTATTTCGAACTGCTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014905.2-2213s1c1
Sequence:CCGGCCATAAGAATCTTGATGGATTCTCGAGAATCCATCAAGATTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014905
VALIDATED
GLS MISSION shRNA shRNA Plasmid DNA
glutaminase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014905.3-2247s21c1
Sequence:CCGGCCATAAGAATCTTGATGGATTCTCGAGAATCCATCAAGATTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014905.3-1610s21c1
Sequence:CCGGGCCCTGAAGCAGTTCGAAATACTCGAGTATTTCGAACTGCTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014905.3-947s21c1
Sequence:CCGGCCTCACACATTGATGAGTTATCTCGAGATAACTCATCAATGTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014905.3-835s21c1
Sequence:CCGGGATGGTGTCATGCTAGACAAACTCGAGTTTGTCTAGCATGACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014905.3-1475s21c1
Sequence:CCGGGCACAGACATGGTTGGTATATCTCGAGATATACCAACCATGTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014905.2-801s1c1
Sequence:CCGGGATGGTGTCATGCTAGACAAACTCGAGTTTGTCTAGCATGACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014905.2-913s1c1
Sequence:CCGGCCTCACACATTGATGAGTTATCTCGAGATAACTCATCAATGTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014905.2-1441s1c1
Sequence:CCGGGCACAGACATGGTTGGTATATCTCGAGATATACCAACCATGTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014905.2-1576s1c1
Sequence:CCGGGCCCTGAAGCAGTTCGAAATACTCGAGTATTTCGAACTGCTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014905.2-2213s1c1
Sequence:CCGGCCATAAGAATCTTGATGGATTCTCGAGAATCCATCAAGATTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014905
VALIDATED
GLS MISSION shRNA Lentiviral Transduction Particles
glutaminase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014905.3-2247s21c1
Sequence:CCGGCCATAAGAATCTTGATGGATTCTCGAGAATCCATCAAGATTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014905.3-1610s21c1
Sequence:CCGGGCCCTGAAGCAGTTCGAAATACTCGAGTATTTCGAACTGCTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014905.3-947s21c1
Sequence:CCGGCCTCACACATTGATGAGTTATCTCGAGATAACTCATCAATGTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014905.3-835s21c1
Sequence:CCGGGATGGTGTCATGCTAGACAAACTCGAGTTTGTCTAGCATGACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014905.3-1475s21c1
Sequence:CCGGGCACAGACATGGTTGGTATATCTCGAGATATACCAACCATGTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014905.2-801s1c1
Sequence:CCGGGATGGTGTCATGCTAGACAAACTCGAGTTTGTCTAGCATGACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014905.2-913s1c1
Sequence:CCGGCCTCACACATTGATGAGTTATCTCGAGATAACTCATCAATGTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014905.2-1441s1c1
Sequence:CCGGGCACAGACATGGTTGGTATATCTCGAGATATACCAACCATGTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014905.2-1576s1c1
Sequence:CCGGGCCCTGAAGCAGTTCGAAATACTCGAGTATTTCGAACTGCTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014905.2-2213s1c1
Sequence:CCGGCCATAAGAATCTTGATGGATTCTCGAGAATCCATCAAGATTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081081
VALIDATED
GLS MISSION shRNA Bacterial Glycerol Stock
glutaminase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081081.2-983s21c1
Sequence:CCGGGAGGGAAGGTTGCTGATTATACTCGAGTATAATCAGCAACCTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081081.2-2246s21c1
Sequence:CCGGATCTCGACGGGTTGCTATAATCTCGAGATTATAGCAACCCGTCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081081.2-3696s21c1
Sequence:CCGGATACTGGACCTACCCTATTATCTCGAGATAATAGGGTAGGTCCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081081.2-1987s21c1
Sequence:CCGGGACATGGAGCAGCGGGATTATCTCGAGATAATCCCGCTGCTCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081081.2-1401s21c1
Sequence:CCGGAGAAAGTGGAGATCGAAATTTCTCGAGAAATTTCGATCTCCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081081
VALIDATED
GLS MISSION shRNA shRNA Plasmid DNA
glutaminase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081081.2-983s21c1
Sequence:CCGGGAGGGAAGGTTGCTGATTATACTCGAGTATAATCAGCAACCTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081081.2-2246s21c1
Sequence:CCGGATCTCGACGGGTTGCTATAATCTCGAGATTATAGCAACCCGTCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081081.2-3696s21c1
Sequence:CCGGATACTGGACCTACCCTATTATCTCGAGATAATAGGGTAGGTCCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081081.2-1987s21c1
Sequence:CCGGGACATGGAGCAGCGGGATTATCTCGAGATAATCCCGCTGCTCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081081.2-1401s21c1
Sequence:CCGGAGAAAGTGGAGATCGAAATTTCTCGAGAAATTTCGATCTCCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081081
VALIDATED
GLS MISSION shRNA Lentiviral Transduction Particles
glutaminase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081081.2-983s21c1
Sequence:CCGGGAGGGAAGGTTGCTGATTATACTCGAGTATAATCAGCAACCTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081081.2-2246s21c1
Sequence:CCGGATCTCGACGGGTTGCTATAATCTCGAGATTATAGCAACCCGTCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081081.2-3696s21c1
Sequence:CCGGATACTGGACCTACCCTATTATCTCGAGATAATAGGGTAGGTCCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081081.2-1987s21c1
Sequence:CCGGGACATGGAGCAGCGGGATTATCTCGAGATAATCCCGCTGCTCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081081.2-1401s21c1
Sequence:CCGGAGAAAGTGGAGATCGAAATTTCTCGAGAAATTTCGATCTCCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks