EMAIL THIS PAGE TO A FRIEND

GLT6D1

glycosyltransferase 6 domain containing 1

47 Gene Product Result for
Synonyms: GLTDC1 GT6M7
UniProtKB ID: Q7Z4J2
Gene ID:
Human(360203) Summary: The GT6 glycosyltransferases gene family, which includes the ABO blood group (ABO; MIM 110300) and GLT6D1, shows a complex evolution pattern, with multiple events of gain and loss in different mammal species. In humans, the ABO gene is considered the sole functional member, although the O allele is null and is fixed in certain populations (summary by Casals et al. (2009) [PubMed 19218399]
Mouse(71103) glycosyltransferase 6 domain containing 1
Rat(296577) glycosyltransferase 6 domain containing 1
sheep(101111786) glycosyltransferase 6 domain containing 1
domestic guinea pig(100721536) glycosyltransferase 6 domain containing 1
naked mole-rat(101722546) glycosyltransferase 6 domain containing 1
domestic cat(101090658) glycosyltransferase 6 domain containing 1
cow(529958) glycosyltransferase 6 domain containing 1
dog(491262) glycosyltransferase 6 domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182974 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182974 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182974 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039095 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039095 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039095 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182974 Rosetta Predictions human pricing
NM_001106559 Rosetta Predictions rat pricing
NM_001039095 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078730 predicted 857
2 SASI_Hs02_00371132 predicted 633
3 SASI_Hs01_00078731 predicted 914
4 SASI_Hs01_00078732 predicted 981
5 SASI_Hs02_00371133 predicted 1023
6 SASI_Hs01_00078734 predicted 296
7 SASI_Hs02_00371134 predicted 294
8 SASI_Hs02_00371135 predicted 917
9 SASI_Hs01_00078739 predicted 488
10 SASI_Hs02_00371136 predicted 983
11 SASI_Hs01_00078733 predicted 1089
12 SASI_Hs01_00078735 predicted 1002
13 SASI_Hs01_00078736 predicted 329
14 SASI_Hs01_00078737 predicted 544
15 SASI_Hs01_00078738 predicted 1084
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220148 predicted 525
2 SASI_Rn02_00220149 predicted 720
3 SASI_Rn02_00220150 predicted 403
4 SASI_Rn02_00220151 predicted 243
5 SASI_Rn02_00220152 predicted 529
6 SASI_Rn02_00220153 predicted 442
7 SASI_Rn02_00220154 predicted 591
8 SASI_Rn02_00220155 predicted 779
9 SASI_Rn02_00220156 predicted 599
10 SASI_Rn02_00220157 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039095 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082205 predicted 741
2 SASI_Mm01_00082207 predicted 788
3 SASI_Mm01_00082208 predicted 378
4 SASI_Mm01_00082209 predicted 650
5 SASI_Mm01_00082210 predicted 838
6 SASI_Mm01_00082211 predicted 648
7 SASI_Mm01_00082212 predicted 707
8 SASI_Mm01_00082213 predicted 716
9 SASI_Mm01_00082214 predicted 439
10 SASI_Mm02_00289782 predicted 693
11 SASI_Mm01_00082206 predicted 417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182974
GLT6D1 MISSION shRNA Bacterial Glycerol Stock
glycosyltransferase 6 domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182974.2-1189s21c1
Sequence:CCGGCATGAGGTTTATGACGAATAACTCGAGTTATTCGTCATAAACCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182974.2-302s21c1
Sequence:CCGGGATGTTGGTTGAGCGTTATTTCTCGAGAAATAACGCTCAACCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182974.1-575s1c1
Sequence:CCGGCCGAGTGATCTTCTACATCATCTCGAGATGATGTAGAAGATCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182974.1-642s1c1
Sequence:CCGGCGAACGTTCAAAGCATTTAAACTCGAGTTTAAATGCTTTGAACGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182974.1-998s1c1
Sequence:CCGGCGGAGTTATTCATGACATCAACTCGAGTTGATGTCATGAATAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182974.1-378s1c1
Sequence:CCGGCGCCCTGATGTTATAACGAAACTCGAGTTTCGTTATAACATCAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182974.1-1155s1c1
Sequence:CCGGGCACATGATTCCCAGAGGAAACTCGAGTTTCCTCTGGGAATCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182974
GLT6D1 MISSION shRNA shRNA Plasmid DNA
glycosyltransferase 6 domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182974.2-1189s21c1
Sequence:CCGGCATGAGGTTTATGACGAATAACTCGAGTTATTCGTCATAAACCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182974.2-302s21c1
Sequence:CCGGGATGTTGGTTGAGCGTTATTTCTCGAGAAATAACGCTCAACCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182974.1-575s1c1
Sequence:CCGGCCGAGTGATCTTCTACATCATCTCGAGATGATGTAGAAGATCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182974.1-642s1c1
Sequence:CCGGCGAACGTTCAAAGCATTTAAACTCGAGTTTAAATGCTTTGAACGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182974.1-998s1c1
Sequence:CCGGCGGAGTTATTCATGACATCAACTCGAGTTGATGTCATGAATAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182974.1-378s1c1
Sequence:CCGGCGCCCTGATGTTATAACGAAACTCGAGTTTCGTTATAACATCAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182974.1-1155s1c1
Sequence:CCGGGCACATGATTCCCAGAGGAAACTCGAGTTTCCTCTGGGAATCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182974
GLT6D1 MISSION shRNA Lentiviral Transduction Particles
glycosyltransferase 6 domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182974.2-1189s21c1
Sequence:CCGGCATGAGGTTTATGACGAATAACTCGAGTTATTCGTCATAAACCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182974.2-302s21c1
Sequence:CCGGGATGTTGGTTGAGCGTTATTTCTCGAGAAATAACGCTCAACCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182974.1-575s1c1
Sequence:CCGGCCGAGTGATCTTCTACATCATCTCGAGATGATGTAGAAGATCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182974.1-642s1c1
Sequence:CCGGCGAACGTTCAAAGCATTTAAACTCGAGTTTAAATGCTTTGAACGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182974.1-998s1c1
Sequence:CCGGCGGAGTTATTCATGACATCAACTCGAGTTGATGTCATGAATAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182974.1-378s1c1
Sequence:CCGGCGCCCTGATGTTATAACGAAACTCGAGTTTCGTTATAACATCAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182974.1-1155s1c1
Sequence:CCGGGCACATGATTCCCAGAGGAAACTCGAGTTTCCTCTGGGAATCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039095
GLT6D1 MISSION shRNA Bacterial Glycerol Stock
glycosyltransferase 6 domain containing 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000252490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039095.1-159s21c1
Sequence:CCGGGAGGAACTTCTGCTCTCAGACCTCGAGGTCTGAGAGCAGAAGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039095.1-149s21c1
Sequence:CCGGCCACCAGGAAGAGGAACTTCTCTCGAGAGAAGTTCCTCTTCCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039095.1-139s21c1
Sequence:CCGGACTTCAGGAACCACCAGGAAGCTCGAGCTTCCTGGTGGTTCCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039095.1-167s21c1
Sequence:CCGGTCTGCTCTCAGACTGGTTTAACTCGAGTTAAACCAGTCTGAGAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039095
GLT6D1 MISSION shRNA shRNA Plasmid DNA
glycosyltransferase 6 domain containing 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000252490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039095.1-159s21c1
Sequence:CCGGGAGGAACTTCTGCTCTCAGACCTCGAGGTCTGAGAGCAGAAGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039095.1-149s21c1
Sequence:CCGGCCACCAGGAAGAGGAACTTCTCTCGAGAGAAGTTCCTCTTCCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039095.1-139s21c1
Sequence:CCGGACTTCAGGAACCACCAGGAAGCTCGAGCTTCCTGGTGGTTCCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039095.1-167s21c1
Sequence:CCGGTCTGCTCTCAGACTGGTTTAACTCGAGTTAAACCAGTCTGAGAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039095
GLT6D1 MISSION shRNA Lentiviral Transduction Particles
glycosyltransferase 6 domain containing 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000252490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039095.1-159s21c1
Sequence:CCGGGAGGAACTTCTGCTCTCAGACCTCGAGGTCTGAGAGCAGAAGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039095.1-149s21c1
Sequence:CCGGCCACCAGGAAGAGGAACTTCTCTCGAGAGAAGTTCCTCTTCCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039095.1-139s21c1
Sequence:CCGGACTTCAGGAACCACCAGGAAGCTCGAGCTTCCTGGTGGTTCCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039095.1-167s21c1
Sequence:CCGGTCTGCTCTCAGACTGGTTTAACTCGAGTTAAACCAGTCTGAGAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks