EMAIL THIS PAGE TO A FRIEND

GLT8D1

glycosyltransferase 8 domain containing 1

86 Gene Product Result for
Synonyms: MSTP139
UniProtKB ID: Q68CQ7, Q7Z4D1, Q8N2J6, Q9P0I5
Gene ID:
Human(55830) Summary: This gene encodes a member of the glycosyltransferase family. The specific function of this protein has not been determined. Alternative splicing results in multiple transcript variants of this gene [provided by RefSeq, May 2013]
Mouse(76485) glycosyltransferase 8 domain containing 1
Rat(306253) glycosyltransferase 8 domain containing 1
Zebrafish(492466) glycosyltransferase 8 domain containing 1
cow(512192) glycosyltransferase 8 domain containing 1
domestic cat(101085697) glycosyltransferase 8 domain containing 1
dog(484731) glycosyltransferase 8 domain containing 1
chicken(415898) glycosyltransferase 8 domain containing 1
domestic guinea pig(100728107) glycosyltransferase 8 domain containing 1
naked mole-rat(101699179) glycosyltransferase 8 domain containing 1
sheep(101109744) glycosyltransferase 8 domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018446 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029626 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029626 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029626 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010983 Rosetta Predictions human pricing
NM_018446 Rosetta Predictions human pricing
NM_152932 Rosetta Predictions human pricing
NM_001007683 Rosetta Predictions rat pricing
NM_029626 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010983 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305953 predicted 1660
2 SASI_Hs01_00045539 predicted 1356
3 SASI_Hs01_00045540 predicted 1910
4 SASI_Hs01_00045541 predicted 1340
5 SASI_Hs01_00045542 predicted 2043
6 SASI_Hs01_00045543 predicted 1611
7 SASI_Hs01_00045544 predicted 1790
8 SASI_Hs01_00045545 predicted 1822
9 SASI_Hs01_00045546 predicted 1656
10 SASI_Hs01_00045547 predicted 1494
11 SASI_Hs01_00045548 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351979 predicted 1433
2 SASI_Hs01_00092928 predicted 1128
3 SASI_Hs02_00351980 predicted 1685
4 SASI_Hs01_00092930 predicted 1104
5 SASI_Hs02_00351981 predicted 1810
6 SASI_Hs01_00092931 predicted 1382
7 SASI_Hs02_00351982 predicted 1564
8 SASI_Hs02_00351983 predicted 1590
9 SASI_Hs02_00351984 predicted 1422
10 SASI_Hs01_00092933 predicted 1265
11 SASI_Hs01_00092929 predicted 1158
12 SASI_Hs01_00092932 predicted 1224
13 SASI_Hs01_00092934 predicted 1418
14 SASI_Hs01_00092935 predicted 809
15 SASI_Hs01_00092936 predicted 1080
16 SASI_Hs01_00092937 predicted 1377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366929 predicted 948
2 SASI_Hs01_00100062 predicted 636
3 SASI_Hs02_00366930 predicted 1200
4 SASI_Hs01_00100063 predicted 624
5 SASI_Hs01_00100064 predicted 1331
6 SASI_Hs01_00100065 predicted 902
7 SASI_Hs01_00100066 predicted 1074
8 SASI_Hs01_00100067 predicted 1109
9 SASI_Hs01_00100068 predicted 942
10 SASI_Hs01_00100069 predicted 784
11 SASI_Hs01_00100070 predicted 323
12 SASI_Hs01_00100071 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007683 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052104 predicted 694
2 SASI_Rn01_00052105 predicted 850
3 SASI_Rn01_00052108 predicted 994
4 SASI_Rn01_00052109 predicted 276
5 SASI_Rn01_00052110 predicted 360
6 SASI_Rn01_00052111 predicted 1145
7 SASI_Rn01_00052112 predicted 823
8 SASI_Rn02_00198827 predicted 676
9 SASI_Rn02_00198828 predicted 1209
10 SASI_Rn01_00052113 predicted 315
11 SASI_Rn01_00052106 predicted 678
12 SASI_Rn01_00052107 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115785 predicted 847
2 SASI_Mm01_00115786 predicted 1507
3 SASI_Mm01_00115787 predicted 428
4 SASI_Mm01_00115788 predicted 1096
5 SASI_Mm02_00335619 predicted 1410
6 SASI_Mm01_00115790 predicted 658
7 SASI_Mm01_00115791 predicted 984
8 SASI_Mm01_00115793 predicted 1001
9 SASI_Mm01_00115794 predicted 1133
10 SASI_Mm02_00335620 predicted 1012
11 SASI_Mm01_00115789 predicted 1301
12 SASI_Mm01_00115792 predicted 792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018446
VALIDATED
GLT8D1 MISSION shRNA Bacterial Glycerol Stock
glycosyltransferase 8 domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018446.1-617s1c1
Sequence:CCGGGCCATATACATGGATGATGATCTCGAGATCATCATCCATGTATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018446.1-760s1c1
Sequence:CCGGCCAGTACAATTACATTGGCTACTCGAGTAGCCAATGTAATTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018446.1-575s1c1
Sequence:CCGGGCAAGGTTCTACTTGCCAATTCTCGAGAATTGGCAAGTAGAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018446.1-196s1c1
Sequence:CCGGCCTCAGCTTGAGCAGTTTGTTCTCGAGAACAAACTGCTCAAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018446.1-870s1c1
Sequence:CCGGCGGAATGGAAACGACAGAATACTCGAGTATTCTGTCGTTTCCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018446.2-700s21c1
Sequence:CCGGCCTCAGCTTGAGCAGTTTGTTCTCGAGAACAAACTGCTCAAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018446.2-1121s21c1
Sequence:CCGGGCCATATACATGGATGATGATCTCGAGATCATCATCCATGTATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_018446.2-1374s21c1
Sequence:CCGGCGGAATGGAAACGACAGAATACTCGAGTATTCTGTCGTTTCCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018446.2-1079s21c1
Sequence:CCGGGCAAGGTTCTACTTGCCAATTCTCGAGAATTGGCAAGTAGAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018446
VALIDATED
GLT8D1 MISSION shRNA shRNA Plasmid DNA
glycosyltransferase 8 domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018446.1-617s1c1
Sequence:CCGGGCCATATACATGGATGATGATCTCGAGATCATCATCCATGTATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018446.1-760s1c1
Sequence:CCGGCCAGTACAATTACATTGGCTACTCGAGTAGCCAATGTAATTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018446.1-575s1c1
Sequence:CCGGGCAAGGTTCTACTTGCCAATTCTCGAGAATTGGCAAGTAGAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018446.1-196s1c1
Sequence:CCGGCCTCAGCTTGAGCAGTTTGTTCTCGAGAACAAACTGCTCAAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018446.1-870s1c1
Sequence:CCGGCGGAATGGAAACGACAGAATACTCGAGTATTCTGTCGTTTCCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018446.2-700s21c1
Sequence:CCGGCCTCAGCTTGAGCAGTTTGTTCTCGAGAACAAACTGCTCAAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018446.2-1121s21c1
Sequence:CCGGGCCATATACATGGATGATGATCTCGAGATCATCATCCATGTATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_018446.2-1374s21c1
Sequence:CCGGCGGAATGGAAACGACAGAATACTCGAGTATTCTGTCGTTTCCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018446.2-1079s21c1
Sequence:CCGGGCAAGGTTCTACTTGCCAATTCTCGAGAATTGGCAAGTAGAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018446
VALIDATED
GLT8D1 MISSION shRNA Lentiviral Transduction Particles
glycosyltransferase 8 domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018446.1-617s1c1
Sequence:CCGGGCCATATACATGGATGATGATCTCGAGATCATCATCCATGTATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018446.1-760s1c1
Sequence:CCGGCCAGTACAATTACATTGGCTACTCGAGTAGCCAATGTAATTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018446.1-575s1c1
Sequence:CCGGGCAAGGTTCTACTTGCCAATTCTCGAGAATTGGCAAGTAGAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018446.1-196s1c1
Sequence:CCGGCCTCAGCTTGAGCAGTTTGTTCTCGAGAACAAACTGCTCAAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018446.1-870s1c1
Sequence:CCGGCGGAATGGAAACGACAGAATACTCGAGTATTCTGTCGTTTCCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018446.2-700s21c1
Sequence:CCGGCCTCAGCTTGAGCAGTTTGTTCTCGAGAACAAACTGCTCAAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018446.2-1121s21c1
Sequence:CCGGGCCATATACATGGATGATGATCTCGAGATCATCATCCATGTATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_018446.2-1374s21c1
Sequence:CCGGCGGAATGGAAACGACAGAATACTCGAGTATTCTGTCGTTTCCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018446.2-1079s21c1
Sequence:CCGGGCAAGGTTCTACTTGCCAATTCTCGAGAATTGGCAAGTAGAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029626
GLT8D1 MISSION shRNA Bacterial Glycerol Stock
glycosyltransferase 8 domain containing 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029626.1-1561s1c1
Sequence:CCGGGCTGGGTAGAAGTCATAGATACTCGAGTATCTATGACTTCTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029626.1-1302s1c1
Sequence:CCGGGCCAAGTTACTTCACTGGAATCTCGAGATTCCAGTGAAGTAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029626.1-576s1c1
Sequence:CCGGGCAGCCATAAACAGCGTTCATCTCGAGATGAACGCTGTTTATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029626.1-974s1c1
Sequence:CCGGCCAGTACAATTACATTGGTTACTCGAGTAACCAATGTAATTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029626.1-1133s1c1
Sequence:CCGGGCTCAATGTAGAAGAGGGATTCTCGAGAATCCCTCTTCTACATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029626.2-1677s21c1
Sequence:CCGGCAGTTTAATCCGAAGACATATCTCGAGATATGTCTTCGGATTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029626.2-1885s21c1
Sequence:CCGGCCAAATGTTTGCTTTACTATACTCGAGTATAGTAAAGCAAACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029626
GLT8D1 MISSION shRNA shRNA Plasmid DNA
glycosyltransferase 8 domain containing 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029626.1-1561s1c1
Sequence:CCGGGCTGGGTAGAAGTCATAGATACTCGAGTATCTATGACTTCTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029626.1-1302s1c1
Sequence:CCGGGCCAAGTTACTTCACTGGAATCTCGAGATTCCAGTGAAGTAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029626.1-576s1c1
Sequence:CCGGGCAGCCATAAACAGCGTTCATCTCGAGATGAACGCTGTTTATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029626.1-974s1c1
Sequence:CCGGCCAGTACAATTACATTGGTTACTCGAGTAACCAATGTAATTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029626.1-1133s1c1
Sequence:CCGGGCTCAATGTAGAAGAGGGATTCTCGAGAATCCCTCTTCTACATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029626.2-1677s21c1
Sequence:CCGGCAGTTTAATCCGAAGACATATCTCGAGATATGTCTTCGGATTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029626.2-1885s21c1
Sequence:CCGGCCAAATGTTTGCTTTACTATACTCGAGTATAGTAAAGCAAACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029626
GLT8D1 MISSION shRNA Lentiviral Transduction Particles
glycosyltransferase 8 domain containing 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029626.1-1561s1c1
Sequence:CCGGGCTGGGTAGAAGTCATAGATACTCGAGTATCTATGACTTCTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029626.1-1302s1c1
Sequence:CCGGGCCAAGTTACTTCACTGGAATCTCGAGATTCCAGTGAAGTAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029626.1-576s1c1
Sequence:CCGGGCAGCCATAAACAGCGTTCATCTCGAGATGAACGCTGTTTATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029626.1-974s1c1
Sequence:CCGGCCAGTACAATTACATTGGTTACTCGAGTAACCAATGTAATTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029626.1-1133s1c1
Sequence:CCGGGCTCAATGTAGAAGAGGGATTCTCGAGAATCCCTCTTCTACATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029626.2-1677s21c1
Sequence:CCGGCAGTTTAATCCGAAGACATATCTCGAGATATGTCTTCGGATTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029626.2-1885s21c1
Sequence:CCGGCCAAATGTTTGCTTTACTATACTCGAGTATAGTAAAGCAAACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks