EMAIL THIS PAGE TO A FRIEND

GLT8D2

glycosyltransferase 8 domain containing 2

54 Gene Product Result for
UniProtKB ID: Q9H1C3, Q96KA2
Gene ID:
Mouse(74782) glycosyltransferase 8 domain containing 2
Rat(366859) glycosyltransferase 8 domain containing 2
sheep(101112212) glycosyltransferase 8 domain containing 2
domestic guinea pig(100724329) glycosyltransferase 8 domain containing 2
naked mole-rat(101701942) glycosyltransferase 8 domain containing 2
Zebrafish(567942) glycosyltransferase 8 domain containing 2
chicken(418085) glycosyltransferase 8 domain containing 2
dog(612239) glycosyltransferase 8 domain containing 2
cow(523294) glycosyltransferase 8 domain containing 2
domestic cat(101082760) glycosyltransferase 8 domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029102 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029102 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029102 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031302 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU042871 MISSION® esiRNA esiRNA targeting mouse Glt8d2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031302 Rosetta Predictions human pricing
XM_001079763 Rosetta Predictions rat pricing
XM_345809 Rosetta Predictions rat pricing
NM_029102 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229938 predicted 1439
2 SASI_Hs01_00229939 predicted 958
3 SASI_Hs01_00229940 predicted 1040
4 SASI_Hs01_00229941 predicted 634
5 SASI_Hs01_00229942 predicted 1553
6 SASI_Hs02_00358747 predicted 1287
7 SASI_Hs01_00229943 predicted 1537
8 SASI_Hs01_00229944 predicted 888
9 SASI_Hs01_00229946 predicted 1016
10 SASI_Hs01_00229947 predicted 1002
11 SASI_Hs01_00229945 predicted 1336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365398 predicted 692
2 SASI_Rn02_00365399 predicted 973
3 SASI_Rn02_00365400 predicted 308
4 SASI_Rn02_00365401 predicted 569
5 SASI_Rn02_00365402 predicted 715
6 SASI_Rn02_00365403 predicted 908
7 SASI_Rn02_00365404 predicted 299
8 SASI_Rn02_00365405 predicted 711
9 SASI_Rn02_00365406 predicted 643
10 SASI_Rn02_00365407 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345809 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398688 predicted 1039
2 SASI_Rn02_00398689 predicted 984
3 SASI_Rn02_00398690 predicted 1024
4 SASI_Rn02_00398691 predicted 1040
5 SASI_Rn02_00398692 predicted 966
6 SASI_Rn02_00398693 predicted 922
7 SASI_Rn02_00398694 predicted 883
8 SASI_Rn02_00398695 predicted 894
9 SASI_Rn02_00398696 predicted 1021
10 SASI_Rn02_00398697 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151199 predicted 1228
2 SASI_Mm02_00334876 predicted 1292
3 SASI_Mm01_00151200 predicted 1151
4 SASI_Mm01_00151201 predicted 812
5 SASI_Mm01_00151202 predicted 867
6 SASI_Mm01_00151203 predicted 1287
7 SASI_Mm01_00151204 predicted 645
8 SASI_Mm01_00151205 predicted 791
9 SASI_Mm01_00151207 predicted 638
10 SASI_Mm01_00151208 predicted 660
11 SASI_Mm01_00151206 predicted 1011
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029102
GLT8D2 MISSION shRNA Bacterial Glycerol Stock
glycosyltransferase 8 domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029102.1-1858s1c1
Sequence:CCGGGCCTGGTCTATACAGTGAGTTCTCGAGAACTCACTGTATAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029102.1-632s1c1
Sequence:CCGGGCATGAGAAAGTCATCTATTTCTCGAGAAATAGATGACTTTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029102.1-239s1c1
Sequence:CCGGGACACTCTGTGGGATTCTGTACTCGAGTACAGAATCCCACAGAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029102.1-1158s1c1
Sequence:CCGGCCTAGTGTTCACAATGACTTACTCGAGTAAGTCATTGTGAACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029102.1-1022s1c1
Sequence:CCGGCGGGAAGTATTCCACCATCAACTCGAGTTGATGGTGGAATACTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029102
GLT8D2 MISSION shRNA shRNA Plasmid DNA
glycosyltransferase 8 domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029102.1-1858s1c1
Sequence:CCGGGCCTGGTCTATACAGTGAGTTCTCGAGAACTCACTGTATAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029102.1-632s1c1
Sequence:CCGGGCATGAGAAAGTCATCTATTTCTCGAGAAATAGATGACTTTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029102.1-239s1c1
Sequence:CCGGGACACTCTGTGGGATTCTGTACTCGAGTACAGAATCCCACAGAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029102.1-1158s1c1
Sequence:CCGGCCTAGTGTTCACAATGACTTACTCGAGTAAGTCATTGTGAACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029102.1-1022s1c1
Sequence:CCGGCGGGAAGTATTCCACCATCAACTCGAGTTGATGGTGGAATACTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029102
GLT8D2 MISSION shRNA Lentiviral Transduction Particles
glycosyltransferase 8 domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029102.1-1858s1c1
Sequence:CCGGGCCTGGTCTATACAGTGAGTTCTCGAGAACTCACTGTATAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029102.1-632s1c1
Sequence:CCGGGCATGAGAAAGTCATCTATTTCTCGAGAAATAGATGACTTTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029102.1-239s1c1
Sequence:CCGGGACACTCTGTGGGATTCTGTACTCGAGTACAGAATCCCACAGAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029102.1-1158s1c1
Sequence:CCGGCCTAGTGTTCACAATGACTTACTCGAGTAAGTCATTGTGAACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029102.1-1022s1c1
Sequence:CCGGCGGGAAGTATTCCACCATCAACTCGAGTTGATGGTGGAATACTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031302
GLT8D2 MISSION shRNA Bacterial Glycerol Stock
glycosyltransferase 8 domain containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031302.2-1481s1c1
Sequence:CCGGCCCTGTATAGAAATGTGGAATCTCGAGATTCCACATTTCTATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031302.2-639s1c1
Sequence:CCGGGCCAACATCTTGTTCTATGTACTCGAGTACATAGAACAAGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031302.2-807s1c1
Sequence:CCGGCCTCTGAACTTTGTTCGATTTCTCGAGAAATCGAACAAAGTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031302.2-1425s1c1
Sequence:CCGGGCAGGGATATTTAAACTCAATCTCGAGATTGAGTTTAAATATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031302.2-669s1c1
Sequence:CCGGCGGAATACTCTGACTCGAATACTCGAGTATTCGAGTCAGAGTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031302
GLT8D2 MISSION shRNA shRNA Plasmid DNA
glycosyltransferase 8 domain containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031302.2-1481s1c1
Sequence:CCGGCCCTGTATAGAAATGTGGAATCTCGAGATTCCACATTTCTATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031302.2-639s1c1
Sequence:CCGGGCCAACATCTTGTTCTATGTACTCGAGTACATAGAACAAGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031302.2-807s1c1
Sequence:CCGGCCTCTGAACTTTGTTCGATTTCTCGAGAAATCGAACAAAGTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031302.2-1425s1c1
Sequence:CCGGGCAGGGATATTTAAACTCAATCTCGAGATTGAGTTTAAATATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031302.2-669s1c1
Sequence:CCGGCGGAATACTCTGACTCGAATACTCGAGTATTCGAGTCAGAGTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031302
GLT8D2 MISSION shRNA Lentiviral Transduction Particles
glycosyltransferase 8 domain containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031302.2-1481s1c1
Sequence:CCGGCCCTGTATAGAAATGTGGAATCTCGAGATTCCACATTTCTATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031302.2-639s1c1
Sequence:CCGGGCCAACATCTTGTTCTATGTACTCGAGTACATAGAACAAGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031302.2-807s1c1
Sequence:CCGGCCTCTGAACTTTGTTCGATTTCTCGAGAAATCGAACAAAGTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031302.2-1425s1c1
Sequence:CCGGGCAGGGATATTTAAACTCAATCTCGAGATTGAGTTTAAATATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031302.2-669s1c1
Sequence:CCGGCGGAATACTCTGACTCGAATACTCGAGTATTCGAGTCAGAGTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks