EMAIL THIS PAGE TO A FRIEND

GLTP

glycolipid transfer protein

52 Gene Product Result for
UniProtKB ID: Q9NZD2, Q53Z13, Q96J68
Gene ID:
Human(51228) Summary: The protein encoded by this gene is similar to bovine and porcine proteins which accelerate transfer of certain glycosphingolipids and glyceroglycolipids between membranes. It is thought to be a cytoplasmic protein. [provided by RefSeq, Jul 2008]
Mouse(56356) glycolipid transfer protein
Rat(288707) glycolipid transfer protein
chicken(429534) glycolipid transfer protein
dog(612989) glycolipid transfer protein
cow(327678) glycolipid transfer protein
domestic cat(101084653) glycolipid transfer protein
domestic guinea pig(100725687) glycolipid transfer protein
naked mole-rat(101706102) glycolipid transfer protein
sheep(101113276) glycolipid transfer protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016433 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019821 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019821 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019821 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU057751 MISSION® esiRNA esiRNA targeting mouse Gltp (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016433 Rosetta Predictions human pricing
NM_001134413 Rosetta Predictions rat pricing
NM_019821 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127448 predicted 565
2 SASI_Hs01_00127449 predicted 567
3 SASI_Hs01_00127450 predicted 579
4 SASI_Hs02_00349458 predicted 653
5 SASI_Hs01_00127451 predicted 534
6 SASI_Hs01_00127453 predicted 501
7 SASI_Hs02_00349459 predicted 678
8 SASI_Hs02_00349460 predicted 649
9 SASI_Hs01_00127454 predicted 503
10 SASI_Hs01_00127455 predicted 572
11 SASI_Hs01_00127452 predicted 579
12 SASI_Hs01_00127456 predicted 542
13 SASI_Hs01_00127457 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134413 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256259 predicted 1137
2 SASI_Rn02_00256260 predicted 971
3 SASI_Rn02_00256261 predicted 1127
4 SASI_Rn02_00256262 predicted 1003
5 SASI_Rn02_00256263 predicted 452
6 SASI_Rn02_00256264 predicted 205
7 SASI_Rn02_00256265 predicted 456
8 SASI_Rn02_00256266 predicted 444
9 SASI_Rn02_00256267 predicted 964
10 SASI_Rn02_00256268 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019821 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179361 predicted 809
2 SASI_Mm02_00325112 predicted 848
3 SASI_Mm01_00179362 predicted 463
4 SASI_Mm01_00179363 predicted 862
5 SASI_Mm01_00179365 predicted 1016
6 SASI_Mm01_00179366 predicted 523
7 SASI_Mm01_00179367 predicted 200
8 SASI_Mm01_00179368 predicted 448
9 SASI_Mm01_00179369 predicted 206
10 SASI_Mm01_00179370 predicted 871
11 SASI_Mm01_00179364 predicted 929
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016433
GLTP MISSION shRNA Bacterial Glycerol Stock
glycolipid transfer protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016433.3-720s1c1
Sequence:CCGGCGCTGAGCTTAACTACAAGGTCTCGAGACCTTGTAGTTAAGCTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016433.3-796s1c1
Sequence:CCGGGCAAACCAGAATCACTGTGAACTCGAGTTCACAGTGATTCTGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016433.3-687s1c1
Sequence:CCGGCGATGTCATCTACGAGATGTACTCGAGTACATCTCGTAGATGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138471    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016433.3-780s1c1
Sequence:CCGGCCACATGGAGAAACAGGCAAACTCGAGTTTGCCTGTTTCTCCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016433.3-522s1c1
Sequence:CCGGCAAGAAGTACCATGGCTGGATCTCGAGATCCAGCCATGGTACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016433.3-343s1c1
Sequence:CCGGGAGAAAGAAATGTATGGAGCACTCGAGTGCTCCATACATTTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016433.3-345s1c1
Sequence:CCGGGAAAGAAATGTATGGAGCAGACTCGAGTCTGCTCCATACATTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016433.3-2170s1c1
Sequence:CCGGGCCTTAACCTTAACTGTTCTTCTCGAGAAGAACAGTTAAGGTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016433.3-1116s21c1
Sequence:CCGGTGTCATCCACCTCGCTTTAAACTCGAGTTTAAAGCGAGGTGGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016433.3-996s21c1
Sequence:CCGGACTGACTTTATACCTTCATTTCTCGAGAAATGAAGGTATAAAGTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016433.3-950s21c1
Sequence:CCGGTAATGATCTTACTTCCAAATCCTCGAGGATTTGGAAGTAAGATCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016433
GLTP MISSION shRNA shRNA Plasmid DNA
glycolipid transfer protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016433.3-720s1c1
Sequence:CCGGCGCTGAGCTTAACTACAAGGTCTCGAGACCTTGTAGTTAAGCTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016433.3-796s1c1
Sequence:CCGGGCAAACCAGAATCACTGTGAACTCGAGTTCACAGTGATTCTGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016433.3-687s1c1
Sequence:CCGGCGATGTCATCTACGAGATGTACTCGAGTACATCTCGTAGATGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138471    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016433.3-780s1c1
Sequence:CCGGCCACATGGAGAAACAGGCAAACTCGAGTTTGCCTGTTTCTCCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016433.3-522s1c1
Sequence:CCGGCAAGAAGTACCATGGCTGGATCTCGAGATCCAGCCATGGTACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016433.3-343s1c1
Sequence:CCGGGAGAAAGAAATGTATGGAGCACTCGAGTGCTCCATACATTTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016433.3-345s1c1
Sequence:CCGGGAAAGAAATGTATGGAGCAGACTCGAGTCTGCTCCATACATTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016433.3-2170s1c1
Sequence:CCGGGCCTTAACCTTAACTGTTCTTCTCGAGAAGAACAGTTAAGGTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016433.3-1116s21c1
Sequence:CCGGTGTCATCCACCTCGCTTTAAACTCGAGTTTAAAGCGAGGTGGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016433.3-996s21c1
Sequence:CCGGACTGACTTTATACCTTCATTTCTCGAGAAATGAAGGTATAAAGTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016433.3-950s21c1
Sequence:CCGGTAATGATCTTACTTCCAAATCCTCGAGGATTTGGAAGTAAGATCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016433
GLTP MISSION shRNA Lentiviral Transduction Particles
glycolipid transfer protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016433.3-720s1c1
Sequence:CCGGCGCTGAGCTTAACTACAAGGTCTCGAGACCTTGTAGTTAAGCTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016433.3-796s1c1
Sequence:CCGGGCAAACCAGAATCACTGTGAACTCGAGTTCACAGTGATTCTGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016433.3-687s1c1
Sequence:CCGGCGATGTCATCTACGAGATGTACTCGAGTACATCTCGTAGATGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138471    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016433.3-780s1c1
Sequence:CCGGCCACATGGAGAAACAGGCAAACTCGAGTTTGCCTGTTTCTCCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016433.3-522s1c1
Sequence:CCGGCAAGAAGTACCATGGCTGGATCTCGAGATCCAGCCATGGTACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016433.3-343s1c1
Sequence:CCGGGAGAAAGAAATGTATGGAGCACTCGAGTGCTCCATACATTTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016433.3-345s1c1
Sequence:CCGGGAAAGAAATGTATGGAGCAGACTCGAGTCTGCTCCATACATTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016433.3-2170s1c1
Sequence:CCGGGCCTTAACCTTAACTGTTCTTCTCGAGAAGAACAGTTAAGGTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016433.3-1116s21c1
Sequence:CCGGTGTCATCCACCTCGCTTTAAACTCGAGTTTAAAGCGAGGTGGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016433.3-996s21c1
Sequence:CCGGACTGACTTTATACCTTCATTTCTCGAGAAATGAAGGTATAAAGTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016433.3-950s21c1
Sequence:CCGGTAATGATCTTACTTCCAAATCCTCGAGGATTTGGAAGTAAGATCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019821
VALIDATED
GLTP MISSION shRNA Bacterial Glycerol Stock
glycolipid transfer protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105210    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019821.2-866s1c1
Sequence:CCGGGCCTATTCTAATGGAGCAATACTCGAGTATTGCTCCATTAGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019821.2-669s1c1
Sequence:CCGGACCAAGATGAATGCGGAGCTTCTCGAGAAGCTCCGCATTCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019821.2-165s1c1
Sequence:CCGGCCGCCCTTCTTTGATTGCCTTCTCGAGAAGGCAATCAAAGAAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019821.2-536s1c1
Sequence:CCGGAGCACCTTACAAGTCCGACTTCTCGAGAAGTCGGACTTGTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019821.2-191s1c1
Sequence:CCGGCCCGGTATTCACGCCCATCAACTCGAGTTGATGGGCGTGAATACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019821.2-191s21c1
Sequence:CCGGCCCGGTATTCACGCCCATCAACTCGAGTTGATGGGCGTGAATACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019821.2-669s21c1
Sequence:CCGGACCAAGATGAATGCGGAGCTTCTCGAGAAGCTCCGCATTCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019821.2-866s21c1
Sequence:CCGGGCCTATTCTAATGGAGCAATACTCGAGTATTGCTCCATTAGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019821.2-536s21c1
Sequence:CCGGAGCACCTTACAAGTCCGACTTCTCGAGAAGTCGGACTTGTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019821.2-165s21c1
Sequence:CCGGCCGCCCTTCTTTGATTGCCTTCTCGAGAAGGCAATCAAAGAAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019821
VALIDATED
GLTP MISSION shRNA shRNA Plasmid DNA
glycolipid transfer protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105210    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019821.2-866s1c1
Sequence:CCGGGCCTATTCTAATGGAGCAATACTCGAGTATTGCTCCATTAGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019821.2-669s1c1
Sequence:CCGGACCAAGATGAATGCGGAGCTTCTCGAGAAGCTCCGCATTCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019821.2-165s1c1
Sequence:CCGGCCGCCCTTCTTTGATTGCCTTCTCGAGAAGGCAATCAAAGAAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019821.2-536s1c1
Sequence:CCGGAGCACCTTACAAGTCCGACTTCTCGAGAAGTCGGACTTGTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019821.2-191s1c1
Sequence:CCGGCCCGGTATTCACGCCCATCAACTCGAGTTGATGGGCGTGAATACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019821.2-191s21c1
Sequence:CCGGCCCGGTATTCACGCCCATCAACTCGAGTTGATGGGCGTGAATACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019821.2-669s21c1
Sequence:CCGGACCAAGATGAATGCGGAGCTTCTCGAGAAGCTCCGCATTCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019821.2-866s21c1
Sequence:CCGGGCCTATTCTAATGGAGCAATACTCGAGTATTGCTCCATTAGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019821.2-536s21c1
Sequence:CCGGAGCACCTTACAAGTCCGACTTCTCGAGAAGTCGGACTTGTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019821.2-165s21c1
Sequence:CCGGCCGCCCTTCTTTGATTGCCTTCTCGAGAAGGCAATCAAAGAAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019821
VALIDATED
GLTP MISSION shRNA Lentiviral Transduction Particles
glycolipid transfer protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105210    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019821.2-866s1c1
Sequence:CCGGGCCTATTCTAATGGAGCAATACTCGAGTATTGCTCCATTAGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019821.2-669s1c1
Sequence:CCGGACCAAGATGAATGCGGAGCTTCTCGAGAAGCTCCGCATTCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019821.2-165s1c1
Sequence:CCGGCCGCCCTTCTTTGATTGCCTTCTCGAGAAGGCAATCAAAGAAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019821.2-536s1c1
Sequence:CCGGAGCACCTTACAAGTCCGACTTCTCGAGAAGTCGGACTTGTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019821.2-191s1c1
Sequence:CCGGCCCGGTATTCACGCCCATCAACTCGAGTTGATGGGCGTGAATACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019821.2-191s21c1
Sequence:CCGGCCCGGTATTCACGCCCATCAACTCGAGTTGATGGGCGTGAATACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019821.2-669s21c1
Sequence:CCGGACCAAGATGAATGCGGAGCTTCTCGAGAAGCTCCGCATTCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019821.2-866s21c1
Sequence:CCGGGCCTATTCTAATGGAGCAATACTCGAGTATTGCTCCATTAGAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019821.2-536s21c1
Sequence:CCGGAGCACCTTACAAGTCCGACTTCTCGAGAAGTCGGACTTGTAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019821.2-165s21c1
Sequence:CCGGCCGCCCTTCTTTGATTGCCTTCTCGAGAAGGCAATCAAAGAAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks