EMAIL THIS PAGE TO A FRIEND

GLTPD1

glycolipid transfer protein domain containing 1

46 Gene Product Result for
Synonyms: CPTP
UniProtKB ID: Q5TA50, Q4G0E6, Q7L5A4
Gene ID:
Mouse(79554) glycolipid transfer protein domain containing 1
Rat(313771) glycolipid transfer protein domain containing 1
Zebrafish(791641) glycolipid transfer protein domain containing 1
cow(505009) glycolipid transfer protein domain containing 1
domestic cat(101080441) glycolipid transfer protein domain containing 1
dog(489595) glycolipid transfer protein domain containing 1
chicken(419417) glycolipid transfer protein domain containing 1
sheep(101107298) glycolipid transfer protein domain containing 1
domestic guinea pig(100729212) glycolipid transfer protein domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA056832 Anti-CPTP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029885 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU072951 MISSION® esiRNA esiRNA targeting mouse Gltpd1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029885 Rosetta Predictions human pricing
NM_001007703 Rosetta Predictions rat pricing
NM_024472 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071293 predicted 430
2 SASI_Hs01_00071294 predicted 1178
3 SASI_Hs01_00071295 predicted 420
4 SASI_Hs01_00071296 predicted 572
5 SASI_Hs01_00071297 predicted 1081
6 SASI_Hs01_00071299 predicted 1012
7 SASI_Hs01_00071300 predicted 995
8 SASI_Hs01_00071301 predicted 520
9 SASI_Hs01_00071302 predicted 1235
10 SASI_Hs02_00307571 predicted 1141
11 SASI_Hs01_00071298 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007703 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116283 predicted 855
2 SASI_Rn01_00116285 predicted 499
3 SASI_Rn01_00116286 predicted 1084
4 SASI_Rn01_00116288 predicted 1096
5 SASI_Rn01_00116289 predicted 463
6 SASI_Rn01_00116290 predicted 1042
7 SASI_Rn01_00116292 predicted 981
8 SASI_Rn02_00198866 predicted 463
9 SASI_Rn02_00198867 predicted 1386
10 SASI_Rn02_00198868 predicted 1183
11 SASI_Rn01_00116284 predicted 1346
12 SASI_Rn01_00116287 predicted 1381
13 SASI_Rn01_00116291 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327855 predicted 1262
2 SASI_Mm01_00112014 predicted 951
3 SASI_Mm01_00112015 predicted 486
4 SASI_Mm01_00112017 predicted 1150
5 SASI_Mm02_00327856 predicted 956
6 SASI_Mm01_00112018 predicted 556
7 SASI_Mm01_00112019 predicted 390
8 SASI_Mm01_00112021 predicted 380
9 SASI_Mm01_00112022 predicted 1024
10 SASI_Mm01_00112023 predicted 1038
11 SASI_Mm01_00112016 predicted 1117
12 SASI_Mm01_00112020 predicted 1109
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029885
GLTPD1 MISSION shRNA Bacterial Glycerol Stock
glycolipid transfer protein domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029885.1-1184s21c1
Sequence:CCGGGTGAGCTGAGCTGGTTAGGAACTCGAGTTCCTAACCAGCTCAGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029885.1-1009s21c1
Sequence:CCGGCAACGTCTCCCAGAAGCTCTACTCGAGTAGAGCTTCTGGGAGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029885.1-586s21c1
Sequence:CCGGGGTCTCCAAGCTGCGGATCATCTCGAGATGATCCGCAGCTTGGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029885.1-558s1c1
Sequence:CCGGCCATCTTCTCATTCATCTCCACTCGAGTGGAGATGAATGAGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029885.1-555s1c1
Sequence:CCGGGCACCATCTTCTCATTCATCTCTCGAGAGATGAATGAGAAGATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029885.1-445s1c1
Sequence:CCGGGAAAGTCGTCCTGGTCAGTTTCTCGAGAAACTGACCAGGACGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029885.1-559s1c1
Sequence:CCGGCATCTTCTCATTCATCTCCAACTCGAGTTGGAGATGAATGAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029885
GLTPD1 MISSION shRNA shRNA Plasmid DNA
glycolipid transfer protein domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029885.1-1184s21c1
Sequence:CCGGGTGAGCTGAGCTGGTTAGGAACTCGAGTTCCTAACCAGCTCAGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029885.1-1009s21c1
Sequence:CCGGCAACGTCTCCCAGAAGCTCTACTCGAGTAGAGCTTCTGGGAGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029885.1-586s21c1
Sequence:CCGGGGTCTCCAAGCTGCGGATCATCTCGAGATGATCCGCAGCTTGGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029885.1-558s1c1
Sequence:CCGGCCATCTTCTCATTCATCTCCACTCGAGTGGAGATGAATGAGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029885.1-555s1c1
Sequence:CCGGGCACCATCTTCTCATTCATCTCTCGAGAGATGAATGAGAAGATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029885.1-445s1c1
Sequence:CCGGGAAAGTCGTCCTGGTCAGTTTCTCGAGAAACTGACCAGGACGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029885.1-559s1c1
Sequence:CCGGCATCTTCTCATTCATCTCCAACTCGAGTTGGAGATGAATGAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029885
GLTPD1 MISSION shRNA Lentiviral Transduction Particles
glycolipid transfer protein domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029885.1-1184s21c1
Sequence:CCGGGTGAGCTGAGCTGGTTAGGAACTCGAGTTCCTAACCAGCTCAGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029885.1-1009s21c1
Sequence:CCGGCAACGTCTCCCAGAAGCTCTACTCGAGTAGAGCTTCTGGGAGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029885.1-586s21c1
Sequence:CCGGGGTCTCCAAGCTGCGGATCATCTCGAGATGATCCGCAGCTTGGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029885.1-558s1c1
Sequence:CCGGCCATCTTCTCATTCATCTCCACTCGAGTGGAGATGAATGAGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029885.1-555s1c1
Sequence:CCGGGCACCATCTTCTCATTCATCTCTCGAGAGATGAATGAGAAGATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029885.1-445s1c1
Sequence:CCGGGAAAGTCGTCCTGGTCAGTTTCTCGAGAAACTGACCAGGACGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029885.1-559s1c1
Sequence:CCGGCATCTTCTCATTCATCTCCAACTCGAGTTGGAGATGAATGAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024472
GLTPD1 MISSION shRNA Bacterial Glycerol Stock
glycolipid transfer protein domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024472.4-958s1c1
Sequence:CCGGCCTTCATTGAGCATGTGTATGCTCGAGCATACACATGCTCAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024472.4-517s21c1
Sequence:CCGGGGGCCGTCTTCTCATTCATTTCTCGAGAAATGAATGAGAAGACGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024472.4-488s21c1
Sequence:CCGGGGGACTTGTCAGGTTTCTAAACTCGAGTTTAGAAACCTGACAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024472.4-811s21c1
Sequence:CCGGATGCCACGCTGGCTAACTATCCTCGAGGATAGTTAGCCAGCGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024472.4-2135s21c1
Sequence:CCGGAGGTGTGTCAGGTGCCTAATTCTCGAGAATTAGGCACCTGACACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024472.4-456s21c1
Sequence:CCGGGTGCTGCTGGACCACTATATTCTCGAGAATATAGTGGTCCAGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191045    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024472.2-1784s1c1
Sequence:CCGGCCCAAGATTCTAAGATGTCAACTCGAGTTGACATCTTAGAATCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191023    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024472.2-1785s1c1
Sequence:CCGGCCAAGATTCTAAGATGTCAATCTCGAGATTGACATCTTAGAATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024472
GLTPD1 MISSION shRNA shRNA Plasmid DNA
glycolipid transfer protein domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024472.4-958s1c1
Sequence:CCGGCCTTCATTGAGCATGTGTATGCTCGAGCATACACATGCTCAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024472.4-517s21c1
Sequence:CCGGGGGCCGTCTTCTCATTCATTTCTCGAGAAATGAATGAGAAGACGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024472.4-488s21c1
Sequence:CCGGGGGACTTGTCAGGTTTCTAAACTCGAGTTTAGAAACCTGACAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024472.4-811s21c1
Sequence:CCGGATGCCACGCTGGCTAACTATCCTCGAGGATAGTTAGCCAGCGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024472.4-2135s21c1
Sequence:CCGGAGGTGTGTCAGGTGCCTAATTCTCGAGAATTAGGCACCTGACACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024472.4-456s21c1
Sequence:CCGGGTGCTGCTGGACCACTATATTCTCGAGAATATAGTGGTCCAGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191045    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024472.2-1784s1c1
Sequence:CCGGCCCAAGATTCTAAGATGTCAACTCGAGTTGACATCTTAGAATCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191023    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024472.2-1785s1c1
Sequence:CCGGCCAAGATTCTAAGATGTCAATCTCGAGATTGACATCTTAGAATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024472
GLTPD1 MISSION shRNA Lentiviral Transduction Particles
glycolipid transfer protein domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024472.4-958s1c1
Sequence:CCGGCCTTCATTGAGCATGTGTATGCTCGAGCATACACATGCTCAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024472.4-517s21c1
Sequence:CCGGGGGCCGTCTTCTCATTCATTTCTCGAGAAATGAATGAGAAGACGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024472.4-488s21c1
Sequence:CCGGGGGACTTGTCAGGTTTCTAAACTCGAGTTTAGAAACCTGACAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024472.4-811s21c1
Sequence:CCGGATGCCACGCTGGCTAACTATCCTCGAGGATAGTTAGCCAGCGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024472.4-2135s21c1
Sequence:CCGGAGGTGTGTCAGGTGCCTAATTCTCGAGAATTAGGCACCTGACACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024472.4-456s21c1
Sequence:CCGGGTGCTGCTGGACCACTATATTCTCGAGAATATAGTGGTCCAGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191045    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024472.2-1784s1c1
Sequence:CCGGCCCAAGATTCTAAGATGTCAACTCGAGTTGACATCTTAGAATCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191023    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024472.2-1785s1c1
Sequence:CCGGCCAAGATTCTAAGATGTCAATCTCGAGATTGACATCTTAGAATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks