EMAIL THIS PAGE TO A FRIEND

GLTPD2

glycolipid transfer protein domain containing 2

47 Gene Product Result for
UniProtKB ID: A6NH11, A7E2T2
Gene ID:
Mouse(216871) glycolipid transfer protein domain containing 2
Rat(497943) glycolipid transfer protein domain containing 2
domestic guinea pig(100716979) glycolipid transfer protein domain containing 2
naked mole-rat(101712536) glycolipid transfer protein domain containing 2
sheep(101115809) glycolipid transfer protein domain containing 2
Zebrafish(565337) glycolipid transfer protein domain containing 2
dog(607478) glycolipid transfer protein domain containing 2
cow(100300004) glycolipid transfer protein domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146020 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146020 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146020 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001014985 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001014985 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001014985 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014985 Rosetta Predictions human pricing
NM_001115030 Rosetta Predictions rat pricing
NM_146020 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033742 predicted 311
2 SASI_Hs01_00033743 predicted 468
3 SASI_Hs02_00306610 predicted 436
4 SASI_Hs01_00033744 predicted 569
5 SASI_Hs02_00306611 predicted 379
6 SASI_Hs01_00033746 predicted 296
7 SASI_Hs02_00306612 predicted 620
8 SASI_Hs01_00033748 predicted 370
9 SASI_Hs02_00306613 predicted 263
10 SASI_Hs01_00033750 predicted 352
11 SASI_Hs01_00033745 predicted 581
12 SASI_Hs01_00033747 predicted 373
13 SASI_Hs01_00033749 predicted 320
14 SASI_Hs01_00033751 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115030 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252473 predicted 430
2 SASI_Rn02_00252474 predicted 565
3 SASI_Rn02_00252475 predicted 1058
4 SASI_Rn02_00252476 predicted 1030
5 SASI_Rn02_00252477 predicted 1080
6 SASI_Rn02_00252478 predicted 1109
7 SASI_Rn02_00252479 predicted 390
8 SASI_Rn02_00252480 predicted 465
9 SASI_Rn02_00252481 predicted 310
10 SASI_Rn02_00252482 predicted 955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046017 predicted 426
2 SASI_Mm01_00046018 predicted 537
3 SASI_Mm01_00046019 predicted 980
4 SASI_Mm02_00341592 predicted 965
5 SASI_Mm01_00046020 predicted 421
6 SASI_Mm01_00046021 predicted 398
7 SASI_Mm01_00046022 predicted 419
8 SASI_Mm01_00046023 predicted 770
9 SASI_Mm01_00046024 predicted 262
10 SASI_Mm01_00046026 predicted 480
11 SASI_Mm01_00046025 predicted 422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146020
GLTPD2 MISSION shRNA Bacterial Glycerol Stock
glycolipid transfer protein domain containing 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146020.1-1060s1c1
Sequence:CCGGCTAGCGGTCCTCTTTAGTGAACTCGAGTTCACTAAAGAGGACCGCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146020.1-985s1c1
Sequence:CCGGCATCAAGAGACCGACCAGAAACTCGAGTTTCTGGTCGGTCTCTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146020.1-527s1c1
Sequence:CCGGCCAATGCTTCACACTACACATCTCGAGATGTGTAGTGTGAAGCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146020.1-61s1c1
Sequence:CCGGGCAATTCCCTTCGCTATCTTACTCGAGTAAGATAGCGAAGGGAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146020.1-425s1c1
Sequence:CCGGGAGAACTACTTAGGTTCCTAACTCGAGTTAGGAACCTAAGTAGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146020.1-57s1c1
Sequence:CCGGCCATGCAATTCCCTTCGCTATCTCGAGATAGCGAAGGGAATTGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146020
GLTPD2 MISSION shRNA shRNA Plasmid DNA
glycolipid transfer protein domain containing 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146020.1-1060s1c1
Sequence:CCGGCTAGCGGTCCTCTTTAGTGAACTCGAGTTCACTAAAGAGGACCGCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146020.1-985s1c1
Sequence:CCGGCATCAAGAGACCGACCAGAAACTCGAGTTTCTGGTCGGTCTCTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146020.1-527s1c1
Sequence:CCGGCCAATGCTTCACACTACACATCTCGAGATGTGTAGTGTGAAGCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146020.1-61s1c1
Sequence:CCGGGCAATTCCCTTCGCTATCTTACTCGAGTAAGATAGCGAAGGGAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146020.1-425s1c1
Sequence:CCGGGAGAACTACTTAGGTTCCTAACTCGAGTTAGGAACCTAAGTAGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146020.1-57s1c1
Sequence:CCGGCCATGCAATTCCCTTCGCTATCTCGAGATAGCGAAGGGAATTGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146020
GLTPD2 MISSION shRNA Lentiviral Transduction Particles
glycolipid transfer protein domain containing 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146020.1-1060s1c1
Sequence:CCGGCTAGCGGTCCTCTTTAGTGAACTCGAGTTCACTAAAGAGGACCGCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146020.1-985s1c1
Sequence:CCGGCATCAAGAGACCGACCAGAAACTCGAGTTTCTGGTCGGTCTCTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146020.1-527s1c1
Sequence:CCGGCCAATGCTTCACACTACACATCTCGAGATGTGTAGTGTGAAGCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146020.1-61s1c1
Sequence:CCGGGCAATTCCCTTCGCTATCTTACTCGAGTAAGATAGCGAAGGGAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146020.1-425s1c1
Sequence:CCGGGAGAACTACTTAGGTTCCTAACTCGAGTTAGGAACCTAAGTAGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146020.1-57s1c1
Sequence:CCGGCCATGCAATTCCCTTCGCTATCTCGAGATAGCGAAGGGAATTGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014985
GLTPD2 MISSION shRNA Bacterial Glycerol Stock
glycolipid transfer protein domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014985.1-101s1c1
Sequence:CCGGCTCAATTCCTCTCGCTATCTTCTCGAGAAGATAGCGAGAGGAATTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014985.1-98s1c1
Sequence:CCGGCCACTCAATTCCTCTCGCTATCTCGAGATAGCGAGAGGAATTGAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014985.1-92s1c1
Sequence:CCGGGTTCAGCCACTCAATTCCTCTCTCGAGAGAGGAATTGAGTGGCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014985.1-126s1c1
Sequence:CCGGCTGCTGCTGCTTTATCTCAGTCTCGAGACTGAGATAAAGCAGCAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014985.1-134s21c1
Sequence:CCGGGCTTTATCTCAGTGTTCGGAGCTCGAGCTCCGAACACTGAGATAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014985.1-261s21c1
Sequence:CCGGAGGAAACAGCCTCCGTGTCTGCTCGAGCAGACACGGAGGCTGTTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014985.1-438s21c1
Sequence:CCGGGCCTTCACCAAGGTGACAGACCTCGAGGTCTGTCACCTTGGTGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014985.1-316s21c1
Sequence:CCGGGGTTCCACGCCAGTCTGAAACCTCGAGGTTTCAGACTGGCGTGGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014985.1-859s21c1
Sequence:CCAGGCACCTTGGAGGATGTCTACACTCGAGTGTAGACATCCTCCAAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014985.1-373s21c1
Sequence:CCGGGATGGAGGGCACTCGTCGAATCTCGAGATTCGACGAGTGCCCTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014985
GLTPD2 MISSION shRNA shRNA Plasmid DNA
glycolipid transfer protein domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014985.1-101s1c1
Sequence:CCGGCTCAATTCCTCTCGCTATCTTCTCGAGAAGATAGCGAGAGGAATTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014985.1-98s1c1
Sequence:CCGGCCACTCAATTCCTCTCGCTATCTCGAGATAGCGAGAGGAATTGAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014985.1-92s1c1
Sequence:CCGGGTTCAGCCACTCAATTCCTCTCTCGAGAGAGGAATTGAGTGGCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014985.1-126s1c1
Sequence:CCGGCTGCTGCTGCTTTATCTCAGTCTCGAGACTGAGATAAAGCAGCAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014985.1-134s21c1
Sequence:CCGGGCTTTATCTCAGTGTTCGGAGCTCGAGCTCCGAACACTGAGATAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014985.1-261s21c1
Sequence:CCGGAGGAAACAGCCTCCGTGTCTGCTCGAGCAGACACGGAGGCTGTTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014985.1-438s21c1
Sequence:CCGGGCCTTCACCAAGGTGACAGACCTCGAGGTCTGTCACCTTGGTGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014985.1-316s21c1
Sequence:CCGGGGTTCCACGCCAGTCTGAAACCTCGAGGTTTCAGACTGGCGTGGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014985.1-859s21c1
Sequence:CCAGGCACCTTGGAGGATGTCTACACTCGAGTGTAGACATCCTCCAAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014985.1-373s21c1
Sequence:CCGGGATGGAGGGCACTCGTCGAATCTCGAGATTCGACGAGTGCCCTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014985
GLTPD2 MISSION shRNA Lentiviral Transduction Particles
glycolipid transfer protein domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014985.1-101s1c1
Sequence:CCGGCTCAATTCCTCTCGCTATCTTCTCGAGAAGATAGCGAGAGGAATTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014985.1-98s1c1
Sequence:CCGGCCACTCAATTCCTCTCGCTATCTCGAGATAGCGAGAGGAATTGAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014985.1-92s1c1
Sequence:CCGGGTTCAGCCACTCAATTCCTCTCTCGAGAGAGGAATTGAGTGGCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014985.1-126s1c1
Sequence:CCGGCTGCTGCTGCTTTATCTCAGTCTCGAGACTGAGATAAAGCAGCAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014985.1-134s21c1
Sequence:CCGGGCTTTATCTCAGTGTTCGGAGCTCGAGCTCCGAACACTGAGATAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014985.1-261s21c1
Sequence:CCGGAGGAAACAGCCTCCGTGTCTGCTCGAGCAGACACGGAGGCTGTTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014985.1-438s21c1
Sequence:CCGGGCCTTCACCAAGGTGACAGACCTCGAGGTCTGTCACCTTGGTGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014985.1-316s21c1
Sequence:CCGGGGTTCCACGCCAGTCTGAAACCTCGAGGTTTCAGACTGGCGTGGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014985.1-859s21c1
Sequence:CCAGGCACCTTGGAGGATGTCTACACTCGAGTGTAGACATCCTCCAAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014985.1-373s21c1
Sequence:CCGGGATGGAGGGCACTCGTCGAATCTCGAGATTCGACGAGTGCCCTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)