EMAIL THIS PAGE TO A FRIEND

GLTSCR1

glioma tumor suppressor candidate region gene 1

82 Gene Product Result for
UniProtKB ID: Q9NZM4, A8MW01
Gene ID:
Mouse(243842) glioma tumor suppressor candidate region gene 1
Rat(292622) glioma tumor suppressor candidate region gene 1
Zebrafish(386775) glioma tumor suppressor candidate region gene 1
cow(531868) glioma tumor suppressor candidate region gene 1
domestic cat(101088287) glioma tumor suppressor candidate region gene 1
dog(612119) glioma tumor suppressor candidate region gene 1
domestic guinea pig(100729885) glioma tumor suppressor candidate region gene 1
naked mole-rat(101715900) glioma tumor suppressor candidate region gene 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015711 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015711 Rosetta Predictions human pricing
NM_001106226 Rosetta Predictions rat pricing
NM_001081418 Rosetta Predictions mouse pricing
XM_900105 Rosetta Predictions mouse pricing
XM_986680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348383 predicted 281
2 SASI_Hs02_00348384 predicted 360
3 SASI_Hs01_00129466 predicted 5124
4 SASI_Hs02_00348385 predicted 268
5 SASI_Hs02_00348386 predicted 404
6 SASI_Hs01_00129467 predicted 4991
7 SASI_Hs01_00129468 predicted 5183
8 SASI_Hs01_00129471 predicted 509
9 SASI_Hs02_00348387 predicted 5139
10 SASI_Hs01_00129472 predicted 3742
11 SASI_Hs01_00129469 predicted 4529
12 SASI_Hs01_00129470 predicted 1108
13 SASI_Hs01_00129473 predicted 3738
14 SASI_Hs01_00129474 predicted 5129
15 SASI_Hs01_00129475 predicted 5201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106226 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216878 predicted 325
2 SASI_Rn02_00216879 predicted 272
3 SASI_Rn02_00216880 predicted 315
4 SASI_Rn02_00216881 predicted 275
5 SASI_Rn02_00216882 predicted 329
6 SASI_Rn02_00216883 predicted 264
7 SASI_Rn02_00216884 predicted 324
8 SASI_Rn02_00216885 predicted 340
9 SASI_Rn02_00216886 predicted 279
10 SASI_Rn02_00216887 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298191 predicted 3041
2 SASI_Mm02_00298192 predicted 1538
3 SASI_Mm02_00298193 predicted 997
4 SASI_Mm02_00298194 predicted 3313
5 SASI_Mm02_00298195 predicted 3323
6 SASI_Mm02_00298196 predicted 4529
7 SASI_Mm02_00298197 predicted 4455
8 SASI_Mm02_00298198 predicted 4831
9 SASI_Mm02_00298199 predicted 1102
10 SASI_Mm02_00298200 predicted 3526
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900105 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272159 predicted 4778
2 SASI_Mm01_00272160 predicted 5718
3 SASI_Mm01_00272161 predicted 5177
4 SASI_Mm01_00272162 predicted 4317
5 SASI_Mm01_00272163 predicted 4885
6 SASI_Mm01_00272164 predicted 5318
7 SASI_Mm01_00272165 predicted 5300
8 SASI_Mm01_00272166 predicted 5771
9 SASI_Mm01_00272167 predicted 5343
10 SASI_Mm01_00272168 predicted 5204
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211737 predicted 3039
2 SASI_Mm01_00211738 predicted 1545
3 SASI_Mm01_00211739 predicted 4648
4 SASI_Mm01_00211740 predicted 1005
5 SASI_Mm01_00211741 predicted 3314
6 SASI_Mm01_00211742 predicted 3334
7 SASI_Mm01_00211743 predicted 4537
8 SASI_Mm01_00211744 predicted 4468
9 SASI_Mm01_00211745 predicted 4833
10 SASI_Mm01_00211746 predicted 1111
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015711
GLTSCR1 MISSION shRNA Bacterial Glycerol Stock
glioma tumor suppressor candidate region gene 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015711.3-4109s21c1
Sequence:CCGGCATCGGGCTCAAGCTCAAGATCTCGAGATCTTGAGCTTGAGCCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015711.3-258s21c1
Sequence:CCGGTTCTTGCATGGATCCGAGAAGCTCGAGCTTCTCGGATCCATGCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015711.3-3586s21c1
Sequence:CCGGACAAAGTGGACGAGGAGTTTGCTCGAGCAAACTCCTCGTCCACTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015711.1-3653s1c1
Sequence:CCGGCCCAGGCCATGCTCAATAAATCTCGAGATTTATTGAGCATGGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015711.1-427s1c1
Sequence:CCGGGACCTAGACTTCCTGGAAGATCTCGAGATCTTCCAGGAAGTCTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015711.1-3114s1c1
Sequence:CCGGCGGAATCATCCTCCAGAACAACTCGAGTTGTTCTGGAGGATGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015711.1-3723s1c1
Sequence:CCGGGATGGTAATGATCGACCGAATCTCGAGATTCGGTCGATCATTACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015711
GLTSCR1 MISSION shRNA shRNA Plasmid DNA
glioma tumor suppressor candidate region gene 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015711.3-4109s21c1
Sequence:CCGGCATCGGGCTCAAGCTCAAGATCTCGAGATCTTGAGCTTGAGCCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015711.3-258s21c1
Sequence:CCGGTTCTTGCATGGATCCGAGAAGCTCGAGCTTCTCGGATCCATGCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015711.3-3586s21c1
Sequence:CCGGACAAAGTGGACGAGGAGTTTGCTCGAGCAAACTCCTCGTCCACTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015711.1-3653s1c1
Sequence:CCGGCCCAGGCCATGCTCAATAAATCTCGAGATTTATTGAGCATGGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015711.1-427s1c1
Sequence:CCGGGACCTAGACTTCCTGGAAGATCTCGAGATCTTCCAGGAAGTCTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015711.1-3114s1c1
Sequence:CCGGCGGAATCATCCTCCAGAACAACTCGAGTTGTTCTGGAGGATGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015711.1-3723s1c1
Sequence:CCGGGATGGTAATGATCGACCGAATCTCGAGATTCGGTCGATCATTACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015711
GLTSCR1 MISSION shRNA Lentiviral Transduction Particles
glioma tumor suppressor candidate region gene 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015711.3-4109s21c1
Sequence:CCGGCATCGGGCTCAAGCTCAAGATCTCGAGATCTTGAGCTTGAGCCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015711.3-258s21c1
Sequence:CCGGTTCTTGCATGGATCCGAGAAGCTCGAGCTTCTCGGATCCATGCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015711.3-3586s21c1
Sequence:CCGGACAAAGTGGACGAGGAGTTTGCTCGAGCAAACTCCTCGTCCACTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015711.1-3653s1c1
Sequence:CCGGCCCAGGCCATGCTCAATAAATCTCGAGATTTATTGAGCATGGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015711.1-427s1c1
Sequence:CCGGGACCTAGACTTCCTGGAAGATCTCGAGATCTTCCAGGAAGTCTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015711.1-3114s1c1
Sequence:CCGGCGGAATCATCCTCCAGAACAACTCGAGTTGTTCTGGAGGATGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015711.1-3723s1c1
Sequence:CCGGGATGGTAATGATCGACCGAATCTCGAGATTCGGTCGATCATTACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081418
GLTSCR1 MISSION shRNA Bacterial Glycerol Stock
glioma tumor suppressor candidate region gene 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081418.1-1009s21c1
Sequence:CCGGTCAACGGGAACTCGGTGTTTGCTCGAGCAAACACCGAGTTCCCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081418.1-4631s21c1
Sequence:CCGGCCCGCAGGATGATACACTTACCTCGAGGTAAGTGTATCATCCTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081418.1-4951s21c1
Sequence:CCGGGACAATTCTTGCCTAAGTTATCTCGAGATAACTTAGGCAAGAATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081418.1-793s21c1
Sequence:CCGGCCTTGGGTCTGACACCTATTCCTCGAGGAATAGGTGTCAGACCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081418.1-4450s21c1
Sequence:CCGGCGGTGGAGGATGAACTATATCCTCGAGGATATAGTTCATCCTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081418
GLTSCR1 MISSION shRNA shRNA Plasmid DNA
glioma tumor suppressor candidate region gene 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081418.1-1009s21c1
Sequence:CCGGTCAACGGGAACTCGGTGTTTGCTCGAGCAAACACCGAGTTCCCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081418.1-4631s21c1
Sequence:CCGGCCCGCAGGATGATACACTTACCTCGAGGTAAGTGTATCATCCTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081418.1-4951s21c1
Sequence:CCGGGACAATTCTTGCCTAAGTTATCTCGAGATAACTTAGGCAAGAATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081418.1-793s21c1
Sequence:CCGGCCTTGGGTCTGACACCTATTCCTCGAGGAATAGGTGTCAGACCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081418.1-4450s21c1
Sequence:CCGGCGGTGGAGGATGAACTATATCCTCGAGGATATAGTTCATCCTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081418
GLTSCR1 MISSION shRNA Lentiviral Transduction Particles
glioma tumor suppressor candidate region gene 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081418.1-1009s21c1
Sequence:CCGGTCAACGGGAACTCGGTGTTTGCTCGAGCAAACACCGAGTTCCCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081418.1-4631s21c1
Sequence:CCGGCCCGCAGGATGATACACTTACCTCGAGGTAAGTGTATCATCCTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081418.1-4951s21c1
Sequence:CCGGGACAATTCTTGCCTAAGTTATCTCGAGATAACTTAGGCAAGAATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081418.1-793s21c1
Sequence:CCGGCCTTGGGTCTGACACCTATTCCTCGAGGAATAGGTGTCAGACCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081418.1-4450s21c1
Sequence:CCGGCGGTGGAGGATGAACTATATCCTCGAGGATATAGTTCATCCTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks