EMAIL THIS PAGE TO A FRIEND

GLTSCR1L

GLTSCR1-like

Synonyms: KIAA0240
UniProtKB ID: Q6AI39, A1L3W2, Q5TFZ3, Q92514
Gene ID:
Mouse(210982) GLTSCR1-like
Rat(301235) GLTSCR1-like
Zebrafish(559084) GLTSCR1-like
dog(474904) GLTSCR1-like
cow(540169) GLTSCR1-like
193 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015349 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001100452 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001100452 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001100452 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024081 MISSION® esiRNA esiRNA human KIAA0240 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015349 Rosetta Predictions human pricing
NM_001106888 Rosetta Predictions rat pricing
XM_001001238 Rosetta Predictions mouse pricing
XM_924235 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231893 predicted 245
2 SASI_Hs02_00347664 predicted 1409
3 SASI_Hs01_00231894 predicted 2772
4 SASI_Hs01_00231895 predicted 1372
5 SASI_Hs01_00231896 predicted 775
6 SASI_Hs01_00231897 predicted 1110
7 SASI_Hs01_00231899 predicted 1213
8 SASI_Hs01_00231900 predicted 235
9 SASI_Hs01_00231901 predicted 1084
10 SASI_Hs02_00347665 predicted 1173
11 SASI_Hs01_00231892 predicted 2392
12 SASI_Hs01_00231898 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223396 predicted 662
2 SASI_Rn02_00223397 predicted 1312
3 SASI_Rn02_00223398 predicted 2690
4 SASI_Rn02_00223399 predicted 1027
5 SASI_Rn02_00223400 predicted 762
6 SASI_Rn02_00223401 predicted 1377
7 SASI_Rn02_00223402 predicted 515
8 SASI_Rn02_00223403 predicted 921
9 SASI_Rn02_00223404 predicted 2524
10 SASI_Rn02_00223405 predicted 2313
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001238 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00355055 predicted 3026
2 SASI_Mm01_00260133 predicted 887
3 SASI_Mm01_00260135 predicted 1025
4 SASI_Mm01_00260136 predicted 388
5 SASI_Mm01_00260137 predicted 661
6 SASI_Mm01_00260138 predicted 2438
7 SASI_Mm01_00260139 predicted 488
8 SASI_Mm01_00260140 predicted 2504
9 SASI_Mm01_00260141 predicted 703
10 SASI_Mm02_00355056 predicted 2126
11 SASI_Mm01_00260132 predicted 1185
12 SASI_Mm01_00260134 predicted 2408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_924235 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00444099 predicted 3034
2 SASI_Mm02_00444100 predicted 892
3 SASI_Mm02_00444101 predicted 1017
4 SASI_Mm02_00444102 predicted 385
5 SASI_Mm02_00444103 predicted 660
6 SASI_Mm02_00444104 predicted 2445
7 SASI_Mm02_00444105 predicted 495
8 SASI_Mm02_00444106 predicted 2507
9 SASI_Mm02_00444107 predicted 705
10 SASI_Mm02_00444108 predicted 2125
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015349
VALIDATED
GLTSCR1L MISSION shRNA Bacterial Glycerol Stock
GLTSCR1-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015349.1-999s1c1
Sequence:CCGGCCGTTCCATTTAACAGCACAACTCGAGTTGTGCTGTTAAATGGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015349.1-603s1c1
Sequence:CCGGCATCCTTTACTCAGGCTTCTACTCGAGTAGAAGCCTGAGTAAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015349.1-1405s21c1
Sequence:CCGGACACCACGTCCAGACTATAAACTCGAGTTTATAGTCTGGACGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015349.1-229s21c1
Sequence:CCGGTCTACATGGACCTAGTAATAACTCGAGTTATTACTAGGTCCATGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015349.1-520s21c1
Sequence:CCGGATTGGCAGAAGAGGCATATTTCTCGAGAAATATGCCTCTTCTGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015349.1-782s21c1
Sequence:CCGGATTAGTGGTTCTGGTCAAATACTCGAGTATTTGACCAGAACCACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015349.1-4243s21c1
Sequence:CCGGATAGAGCCATGAGGGTTATAACTCGAGTTATAACCCTCATGGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015349
VALIDATED
GLTSCR1L MISSION shRNA shRNA Plasmid DNA
GLTSCR1-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015349.1-999s1c1
Sequence:CCGGCCGTTCCATTTAACAGCACAACTCGAGTTGTGCTGTTAAATGGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015349.1-603s1c1
Sequence:CCGGCATCCTTTACTCAGGCTTCTACTCGAGTAGAAGCCTGAGTAAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015349.1-1405s21c1
Sequence:CCGGACACCACGTCCAGACTATAAACTCGAGTTTATAGTCTGGACGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015349.1-229s21c1
Sequence:CCGGTCTACATGGACCTAGTAATAACTCGAGTTATTACTAGGTCCATGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015349.1-520s21c1
Sequence:CCGGATTGGCAGAAGAGGCATATTTCTCGAGAAATATGCCTCTTCTGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015349.1-782s21c1
Sequence:CCGGATTAGTGGTTCTGGTCAAATACTCGAGTATTTGACCAGAACCACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015349.1-4243s21c1
Sequence:CCGGATAGAGCCATGAGGGTTATAACTCGAGTTATAACCCTCATGGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015349
VALIDATED
GLTSCR1L MISSION shRNA Lentiviral Transduction Particles
GLTSCR1-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015349.1-999s1c1
Sequence:CCGGCCGTTCCATTTAACAGCACAACTCGAGTTGTGCTGTTAAATGGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015349.1-603s1c1
Sequence:CCGGCATCCTTTACTCAGGCTTCTACTCGAGTAGAAGCCTGAGTAAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015349.1-1405s21c1
Sequence:CCGGACACCACGTCCAGACTATAAACTCGAGTTTATAGTCTGGACGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015349.1-229s21c1
Sequence:CCGGTCTACATGGACCTAGTAATAACTCGAGTTATTACTAGGTCCATGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015349.1-520s21c1
Sequence:CCGGATTGGCAGAAGAGGCATATTTCTCGAGAAATATGCCTCTTCTGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015349.1-782s21c1
Sequence:CCGGATTAGTGGTTCTGGTCAAATACTCGAGTATTTGACCAGAACCACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015349.1-4243s21c1
Sequence:CCGGATAGAGCCATGAGGGTTATAACTCGAGTTATAACCCTCATGGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100452
VALIDATED
GLTSCR1L MISSION shRNA Bacterial Glycerol Stock
GLTSCR1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001100452.1-1665s21c1
Sequence:CCGGCACCATGTCCAGGCTATAAACCTCGAGGTTTATAGCCTGGACATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001100452.1-3901s21c1
Sequence:CCGGGGCCATTGTTGTTCGTTAATTCTCGAGAATTAACGAACAACAATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001100452.1-1066s21c1
Sequence:CCGGTAATCGGGTCCTTCGGTAATCCTCGAGGATTACCGAAGGACCCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001100452.1-577s21c1
Sequence:CCGGCCACGAACGCTGACCCTAAATCTCGAGATTTAGGGTCAGCGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001100452.1-1088s21c1
Sequence:CCGGGCCTTCCATGATGACTATAAACTCGAGTTTATAGTCATCATGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100452
VALIDATED
GLTSCR1L MISSION shRNA shRNA Plasmid DNA
GLTSCR1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001100452.1-1665s21c1
Sequence:CCGGCACCATGTCCAGGCTATAAACCTCGAGGTTTATAGCCTGGACATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001100452.1-3901s21c1
Sequence:CCGGGGCCATTGTTGTTCGTTAATTCTCGAGAATTAACGAACAACAATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001100452.1-1066s21c1
Sequence:CCGGTAATCGGGTCCTTCGGTAATCCTCGAGGATTACCGAAGGACCCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001100452.1-577s21c1
Sequence:CCGGCCACGAACGCTGACCCTAAATCTCGAGATTTAGGGTCAGCGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001100452.1-1088s21c1
Sequence:CCGGGCCTTCCATGATGACTATAAACTCGAGTTTATAGTCATCATGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100452
VALIDATED
GLTSCR1L MISSION shRNA Lentiviral Transduction Particles
GLTSCR1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001100452.1-1665s21c1
Sequence:CCGGCACCATGTCCAGGCTATAAACCTCGAGGTTTATAGCCTGGACATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001100452.1-3901s21c1
Sequence:CCGGGGCCATTGTTGTTCGTTAATTCTCGAGAATTAACGAACAACAATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001100452.1-1066s21c1
Sequence:CCGGTAATCGGGTCCTTCGGTAATCCTCGAGGATTACCGAAGGACCCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001100452.1-577s21c1
Sequence:CCGGCCACGAACGCTGACCCTAAATCTCGAGATTTAGGGTCAGCGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001100452.1-1088s21c1
Sequence:CCGGGCCTTCCATGATGACTATAAACTCGAGTTTATAGTCATCATGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks