EMAIL THIS PAGE TO A FRIEND

GLTSCR2

glioma tumor suppressor candidate region gene 2

54 Gene Product Result for
Synonyms: PICT-1 PICT1
UniProtKB ID: Q9NZM5, Q9BTC6, Q9HAX6, Q9NPP1, Q9NPR4, Q9UFI2
Gene ID:
Mouse(68077) glioma tumor suppressor candidate region gene 2
Rat(292624) glioma tumor suppressor candidate region gene 2
Zebrafish(322404) glioma tumor suppressor candidate region gene 2
dog(476424) glioma tumor suppressor candidate region gene 2
cow(506401) glioma tumor suppressor candidate region gene 2
domestic cat(101087798) glioma tumor suppressor candidate region gene 2
sheep(101103418) glioma tumor suppressor candidate region gene 2
domestic guinea pig(100720217) glioma tumor suppressor candidate region gene 2
naked mole-rat(101706610) glioma tumor suppressor candidate region gene 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133831 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133831 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133831 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015710 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015710 siRNAs that have been validated in the lab human pricing
NM_207591 Rosetta Predictions rat pricing
NM_133831 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015710 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176592 validated 732
2 SASI_Hs01_00176590 predicted 329
3 SASI_Hs01_00176591 predicted 304
4 SASI_Hs01_00176593 predicted 294
5 SASI_Hs01_00176594 predicted 431
6 SASI_Hs01_00176595 predicted 361
7 SASI_Hs01_00176596 predicted 567
8 SASI_Hs01_00176597 predicted 324
9 SASI_Hs01_00176598 predicted 733
10 SASI_Hs01_00176599 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062223 predicted 242
2 SASI_Rn01_00062225 predicted 615
3 SASI_Rn01_00062226 predicted 584
4 SASI_Rn01_00062227 predicted 582
5 SASI_Rn02_00270409 predicted 1088
6 SASI_Rn01_00062228 predicted 854
7 SASI_Rn01_00062229 predicted 886
8 SASI_Rn01_00062230 predicted 593
9 SASI_Rn01_00062231 predicted 583
10 SASI_Rn01_00062232 predicted 1040
11 SASI_Rn01_00062224 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174490 predicted 1104
2 SASI_Mm01_00174488 predicted 1282
3 SASI_Mm01_00174491 predicted 274
4 SASI_Mm01_00174492 predicted 613
5 SASI_Mm01_00174493 predicted 1109
6 SASI_Mm01_00174494 predicted 909
7 SASI_Mm01_00174496 predicted 963
8 SASI_Mm01_00174489 predicted 911
9 SASI_Mm02_00338854 predicted 1049
10 SASI_Mm02_00338855 predicted 408
11 SASI_Mm01_00174495 predicted 489
12 SASI_Mm01_00174497 predicted 648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133831
VALIDATED
GLTSCR2 MISSION shRNA Bacterial Glycerol Stock
glioma tumor suppressor candidate region gene 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133831.3-788s21c1
Sequence:CCGGGCCTCCTACAACCCAACCTTTCTCGAGAAAGGTTGGGTTGTAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133831.3-383s21c1
Sequence:CCGGCAGCGTCTCCAGAAACCCTTACTCGAGTAAGGGTTTCTGGAGACGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133831.3-418s21c1
Sequence:CCGGCCTTGAGAATCATTCTAAGATCTCGAGATCTTAGAATGATTCTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133831.3-968s21c1
Sequence:CCGGTCTGATGGTGAGGATGAGCATCTCGAGATGCTCATCCTCACCATCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133831.1-1078s1c1
Sequence:CCGGGCGGGAGAAAGCTGCTCGCAACTCGAGTTGCGAGCAGCTTTCTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133831.1-394s1c1
Sequence:CCGGCCTTGAGAATCATTCTAAGATCTCGAGATCTTAGAATGATTCTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133831.1-764s1c1
Sequence:CCGGGCCTCCTACAACCCAACCTTTCTCGAGAAAGGTTGGGTTGTAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133831.1-359s1c1
Sequence:CCGGCAGCGTCTCCAGAAACCCTTACTCGAGTAAGGGTTTCTGGAGACGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133831
VALIDATED
GLTSCR2 MISSION shRNA shRNA Plasmid DNA
glioma tumor suppressor candidate region gene 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133831.3-788s21c1
Sequence:CCGGGCCTCCTACAACCCAACCTTTCTCGAGAAAGGTTGGGTTGTAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133831.3-383s21c1
Sequence:CCGGCAGCGTCTCCAGAAACCCTTACTCGAGTAAGGGTTTCTGGAGACGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133831.3-418s21c1
Sequence:CCGGCCTTGAGAATCATTCTAAGATCTCGAGATCTTAGAATGATTCTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133831.3-968s21c1
Sequence:CCGGTCTGATGGTGAGGATGAGCATCTCGAGATGCTCATCCTCACCATCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133831.1-1078s1c1
Sequence:CCGGGCGGGAGAAAGCTGCTCGCAACTCGAGTTGCGAGCAGCTTTCTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133831.1-394s1c1
Sequence:CCGGCCTTGAGAATCATTCTAAGATCTCGAGATCTTAGAATGATTCTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133831.1-764s1c1
Sequence:CCGGGCCTCCTACAACCCAACCTTTCTCGAGAAAGGTTGGGTTGTAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133831.1-359s1c1
Sequence:CCGGCAGCGTCTCCAGAAACCCTTACTCGAGTAAGGGTTTCTGGAGACGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133831
VALIDATED
GLTSCR2 MISSION shRNA Lentiviral Transduction Particles
glioma tumor suppressor candidate region gene 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133831.3-788s21c1
Sequence:CCGGGCCTCCTACAACCCAACCTTTCTCGAGAAAGGTTGGGTTGTAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133831.3-383s21c1
Sequence:CCGGCAGCGTCTCCAGAAACCCTTACTCGAGTAAGGGTTTCTGGAGACGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133831.3-418s21c1
Sequence:CCGGCCTTGAGAATCATTCTAAGATCTCGAGATCTTAGAATGATTCTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133831.3-968s21c1
Sequence:CCGGTCTGATGGTGAGGATGAGCATCTCGAGATGCTCATCCTCACCATCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133831.1-1078s1c1
Sequence:CCGGGCGGGAGAAAGCTGCTCGCAACTCGAGTTGCGAGCAGCTTTCTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133831.1-394s1c1
Sequence:CCGGCCTTGAGAATCATTCTAAGATCTCGAGATCTTAGAATGATTCTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133831.1-764s1c1
Sequence:CCGGGCCTCCTACAACCCAACCTTTCTCGAGAAAGGTTGGGTTGTAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133831.1-359s1c1
Sequence:CCGGCAGCGTCTCCAGAAACCCTTACTCGAGTAAGGGTTTCTGGAGACGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015710
VALIDATED
GLTSCR2 MISSION shRNA Bacterial Glycerol Stock
glioma tumor suppressor candidate region gene 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015710.3-123s21c1
Sequence:CCGGGCGAGGCCCAAGAAATAAGAACTCGAGTTCTTATTTCTTGGGCCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015710.3-657s21c1
Sequence:CCGGGACCAAGAAGAAAGGAGTGAACTCGAGTTCACTCCTTTCTTCTTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015710.3-300s21c1
Sequence:CCGGGCTGACAAAGAAGAGAACCAACTCGAGTTGGTTCTCTTCTTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015710.3-741s21c1
Sequence:CCGGAGCTTCCTACAATCCATCCTTCTCGAGAAGGATGGATTGTAGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015710.2-700s1c1
Sequence:CCGGGACCAAGAAGAAAGGAGTGAACTCGAGTTCACTCCTTTCTTCTTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015710.2-784s1c1
Sequence:CCGGAGCTTCCTACAATCCATCCTTCTCGAGAAGGATGGATTGTAGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015710.2-1429s1c1
Sequence:CCGGCAAACGCAAGTACAAGGTGAACTCGAGTTCACCTTGTACTTGCGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015710.2-166s1c1
Sequence:CCGGGCGAGGCCCAAGAAATAAGAACTCGAGTTCTTATTTCTTGGGCCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015710.2-343s1c1
Sequence:CCGGGCTGACAAAGAAGAGAACCAACTCGAGTTGGTTCTCTTCTTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015710
VALIDATED
GLTSCR2 MISSION shRNA shRNA Plasmid DNA
glioma tumor suppressor candidate region gene 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015710.3-123s21c1
Sequence:CCGGGCGAGGCCCAAGAAATAAGAACTCGAGTTCTTATTTCTTGGGCCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015710.3-657s21c1
Sequence:CCGGGACCAAGAAGAAAGGAGTGAACTCGAGTTCACTCCTTTCTTCTTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015710.3-300s21c1
Sequence:CCGGGCTGACAAAGAAGAGAACCAACTCGAGTTGGTTCTCTTCTTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015710.3-741s21c1
Sequence:CCGGAGCTTCCTACAATCCATCCTTCTCGAGAAGGATGGATTGTAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015710.2-700s1c1
Sequence:CCGGGACCAAGAAGAAAGGAGTGAACTCGAGTTCACTCCTTTCTTCTTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015710.2-784s1c1
Sequence:CCGGAGCTTCCTACAATCCATCCTTCTCGAGAAGGATGGATTGTAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015710.2-1429s1c1
Sequence:CCGGCAAACGCAAGTACAAGGTGAACTCGAGTTCACCTTGTACTTGCGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015710.2-166s1c1
Sequence:CCGGGCGAGGCCCAAGAAATAAGAACTCGAGTTCTTATTTCTTGGGCCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015710.2-343s1c1
Sequence:CCGGGCTGACAAAGAAGAGAACCAACTCGAGTTGGTTCTCTTCTTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015710
VALIDATED
GLTSCR2 MISSION shRNA Lentiviral Transduction Particles
glioma tumor suppressor candidate region gene 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015710.3-123s21c1
Sequence:CCGGGCGAGGCCCAAGAAATAAGAACTCGAGTTCTTATTTCTTGGGCCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015710.3-657s21c1
Sequence:CCGGGACCAAGAAGAAAGGAGTGAACTCGAGTTCACTCCTTTCTTCTTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015710.3-300s21c1
Sequence:CCGGGCTGACAAAGAAGAGAACCAACTCGAGTTGGTTCTCTTCTTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015710.3-741s21c1
Sequence:CCGGAGCTTCCTACAATCCATCCTTCTCGAGAAGGATGGATTGTAGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015710.2-700s1c1
Sequence:CCGGGACCAAGAAGAAAGGAGTGAACTCGAGTTCACTCCTTTCTTCTTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015710.2-784s1c1
Sequence:CCGGAGCTTCCTACAATCCATCCTTCTCGAGAAGGATGGATTGTAGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015710.2-1429s1c1
Sequence:CCGGCAAACGCAAGTACAAGGTGAACTCGAGTTCACCTTGTACTTGCGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015710.2-166s1c1
Sequence:CCGGGCGAGGCCCAAGAAATAAGAACTCGAGTTCTTATTTCTTGGGCCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015710.2-343s1c1
Sequence:CCGGGCTGACAAAGAAGAGAACCAACTCGAGTTGGTTCTCTTCTTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)