EMAIL THIS PAGE TO A FRIEND

GLUD1

glutamate dehydrogenase 1

89 Gene Product Result for
Synonyms: GDH GDH1 GLUD
UniProtKB ID: P00367, Q5TBU3
Gene ID:
Human(2746) Summary: This gene encodes glutamate dehydrogenase protein; a mitochondrial matrix enzyme that catalyzes the oxidative deamination of glutamate to alpha-ketoglutarate and ammonia. This enzyme has an important role in regulating amino acid induced insulin secretion and activating mutations in this gene are a common cause of congenital hyperinsulinism. This enzyme is allosterically activated by ADP and inhibited by GTP and ATP. The related glutamate dehydrogenase 2 gene on the human X-chromosome originated from this gene via retrotransposition and encodes a soluble form of glutamate dehydrogenase. Multiple pseudogenes of this gene are present in humans.[provided by RefSeq, Sep 2009]
Mouse(14661) glutamate dehydrogenase 1
Rat(24399) glutamate dehydrogenase 1
sheep(443239) glutamate dehydrogenase 1
domestic guinea pig(100722523) glutamate dehydrogenase 1
naked mole-rat(101699446) glutamate dehydrogenase 1
chicken(423612) glutamate dehydrogenase 1
dog(100684847) glutamate dehydrogenase 1
cow(281785) glutamate dehydrogenase 1
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008133 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008133 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008133 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005271 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005271 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005271 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005271 Rosetta Predictions human pricing
NM_012570 Rosetta Predictions rat pricing
NM_008133 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082304 predicted 1788
2 SASI_Hs01_00082305 predicted 1790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012570 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077445 predicted 916
2 SASI_Rn01_00077446 predicted 1816
3 SASI_Rn01_00077447 predicted 1681
4 SASI_Rn01_00077448 predicted 950
5 SASI_Rn01_00077449 predicted 794
6 SASI_Rn01_00077450 predicted 963
7 SASI_Rn01_00077452 predicted 1309
8 SASI_Rn01_00077453 predicted 1441
9 SASI_Rn01_00077454 predicted 777
10 SASI_Rn02_00259688 predicted 1107
11 SASI_Rn01_00077451 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008133 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044129 predicted 678
2 SASI_Mm01_00044130 predicted 1882
3 SASI_Mm01_00044131 predicted 867
4 SASI_Mm01_00044132 predicted 966
5 SASI_Mm01_00044133 predicted 1040
6 SASI_Mm01_00044134 predicted 1878
7 SASI_Mm01_00044135 predicted 996
8 SASI_Mm01_00044136 predicted 713
9 SASI_Mm01_00044137 predicted 686
10 SASI_Mm02_00313201 predicted 760
11 SASI_Mm01_00044138 predicted 1049
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008133
VALIDATED
GLUD1 MISSION shRNA Bacterial Glycerol Stock
glutamate dehydrogenase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008133.2-1229s1c1
Sequence:CCGGCCCAAAGCCAAGGTCTATGAACTCGAGTTCATAGACCTTGGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008133.2-713s1c1
Sequence:CCGGCCCAAGAACTATACAGATAATCTCGAGATTATCTGTATAGTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008133.2-1137s1c1
Sequence:CCGGGAGAGTCTGATGGGAGTATATCTCGAGATATACTCCCATCAGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008133.2-608s1c1
Sequence:CCGGGACGTGAGTGTGGATGAAGTACTCGAGTACTTCATCCACACTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008133.2-1498s1c1
Sequence:CCGGCGGCCGATTGACCTTCAAATACTCGAGTATTTGAAGGTCAATCGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008133.4-1524s21c1
Sequence:CCGGCGGCCGATTGACCTTCAAATACTCGAGTATTTGAAGGTCAATCGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008133.4-1255s21c1
Sequence:CCGGCCCAAAGCCAAGGTCTATGAACTCGAGTTCATAGACCTTGGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008133.4-634s21c1
Sequence:CCGGGACGTGAGTGTGGATGAAGTACTCGAGTACTTCATCCACACTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008133.4-739s21c1
Sequence:CCGGCCCAAGAACTATACAGATAATCTCGAGATTATCTGTATAGTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008133.4-1163s21c1
Sequence:CCGGGAGAGTCTGATGGGAGTATATCTCGAGATATACTCCCATCAGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008133
VALIDATED
GLUD1 MISSION shRNA shRNA Plasmid DNA
glutamate dehydrogenase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008133.2-1229s1c1
Sequence:CCGGCCCAAAGCCAAGGTCTATGAACTCGAGTTCATAGACCTTGGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008133.2-713s1c1
Sequence:CCGGCCCAAGAACTATACAGATAATCTCGAGATTATCTGTATAGTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008133.2-1137s1c1
Sequence:CCGGGAGAGTCTGATGGGAGTATATCTCGAGATATACTCCCATCAGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008133.2-608s1c1
Sequence:CCGGGACGTGAGTGTGGATGAAGTACTCGAGTACTTCATCCACACTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008133.2-1498s1c1
Sequence:CCGGCGGCCGATTGACCTTCAAATACTCGAGTATTTGAAGGTCAATCGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008133.4-1524s21c1
Sequence:CCGGCGGCCGATTGACCTTCAAATACTCGAGTATTTGAAGGTCAATCGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008133.4-1255s21c1
Sequence:CCGGCCCAAAGCCAAGGTCTATGAACTCGAGTTCATAGACCTTGGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008133.4-634s21c1
Sequence:CCGGGACGTGAGTGTGGATGAAGTACTCGAGTACTTCATCCACACTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008133.4-739s21c1
Sequence:CCGGCCCAAGAACTATACAGATAATCTCGAGATTATCTGTATAGTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008133.4-1163s21c1
Sequence:CCGGGAGAGTCTGATGGGAGTATATCTCGAGATATACTCCCATCAGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008133
VALIDATED
GLUD1 MISSION shRNA Lentiviral Transduction Particles
glutamate dehydrogenase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008133.2-1229s1c1
Sequence:CCGGCCCAAAGCCAAGGTCTATGAACTCGAGTTCATAGACCTTGGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008133.2-713s1c1
Sequence:CCGGCCCAAGAACTATACAGATAATCTCGAGATTATCTGTATAGTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008133.2-1137s1c1
Sequence:CCGGGAGAGTCTGATGGGAGTATATCTCGAGATATACTCCCATCAGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008133.2-608s1c1
Sequence:CCGGGACGTGAGTGTGGATGAAGTACTCGAGTACTTCATCCACACTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008133.2-1498s1c1
Sequence:CCGGCGGCCGATTGACCTTCAAATACTCGAGTATTTGAAGGTCAATCGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008133.4-1524s21c1
Sequence:CCGGCGGCCGATTGACCTTCAAATACTCGAGTATTTGAAGGTCAATCGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008133.4-1255s21c1
Sequence:CCGGCCCAAAGCCAAGGTCTATGAACTCGAGTTCATAGACCTTGGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008133.4-634s21c1
Sequence:CCGGGACGTGAGTGTGGATGAAGTACTCGAGTACTTCATCCACACTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008133.4-739s21c1
Sequence:CCGGCCCAAGAACTATACAGATAATCTCGAGATTATCTGTATAGTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008133.4-1163s21c1
Sequence:CCGGGAGAGTCTGATGGGAGTATATCTCGAGATATACTCCCATCAGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005271
VALIDATED
GLUD1 MISSION shRNA Bacterial Glycerol Stock
glutamate dehydrogenase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005271.1-1706s1c1
Sequence:CCGGGCTGCCTATGTTAATGCCATTCTCGAGAATGGCATTAACATAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005271.1-1568s1c1
Sequence:CCGGGCAGAGTTCCAAGACAGGATACTCGAGTATCCTGTCTTGGAACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005271.1-665s1c1
Sequence:CCGGCCCAAGAACTATACTGATAATCTCGAGATTATCAGTATAGTTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005271.1-1721s1c1
Sequence:CCGGGCCATTGAGAAAGTCTTCAAACTCGAGTTTGAAGACTTTCTCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005271.1-1192s1c1
Sequence:CCGGGCCCTATGAAGGAAGCATCTTCTCGAGAAGATGCTTCCTTCATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005271.2-851s21c1
Sequence:CCGGCACGCCTGTGTTACTGGTAAACTCGAGTTTACCAGTAACACAGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005271.2-1642s21c1
Sequence:CCGGGCGTTCTGCCAGGCAAATTATCTCGAGATAATTTGCCTGGCAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343656    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005271.2-2217s21c1
Sequence:CCGGTCAAGTGAGTTCTTAGTATTTCTCGAGAAATACTAAGAACTCACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005271.2-1568s21c1
Sequence:CCGGGCAGAGTTCCAAGACAGGATACTCGAGTATCCTGTCTTGGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005271.2-1721s21c1
Sequence:CCGGGCCATTGAGAAAGTCTTCAAACTCGAGTTTGAAGACTTTCTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005271
VALIDATED
GLUD1 MISSION shRNA shRNA Plasmid DNA
glutamate dehydrogenase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005271.1-1706s1c1
Sequence:CCGGGCTGCCTATGTTAATGCCATTCTCGAGAATGGCATTAACATAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005271.1-1568s1c1
Sequence:CCGGGCAGAGTTCCAAGACAGGATACTCGAGTATCCTGTCTTGGAACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005271.1-665s1c1
Sequence:CCGGCCCAAGAACTATACTGATAATCTCGAGATTATCAGTATAGTTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005271.1-1721s1c1
Sequence:CCGGGCCATTGAGAAAGTCTTCAAACTCGAGTTTGAAGACTTTCTCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005271.1-1192s1c1
Sequence:CCGGGCCCTATGAAGGAAGCATCTTCTCGAGAAGATGCTTCCTTCATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005271.2-851s21c1
Sequence:CCGGCACGCCTGTGTTACTGGTAAACTCGAGTTTACCAGTAACACAGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005271.2-1642s21c1
Sequence:CCGGGCGTTCTGCCAGGCAAATTATCTCGAGATAATTTGCCTGGCAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343656    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005271.2-2217s21c1
Sequence:CCGGTCAAGTGAGTTCTTAGTATTTCTCGAGAAATACTAAGAACTCACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005271.2-1568s21c1
Sequence:CCGGGCAGAGTTCCAAGACAGGATACTCGAGTATCCTGTCTTGGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005271.2-1721s21c1
Sequence:CCGGGCCATTGAGAAAGTCTTCAAACTCGAGTTTGAAGACTTTCTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005271
VALIDATED
GLUD1 MISSION shRNA Lentiviral Transduction Particles
glutamate dehydrogenase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005271.1-1706s1c1
Sequence:CCGGGCTGCCTATGTTAATGCCATTCTCGAGAATGGCATTAACATAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005271.1-1568s1c1
Sequence:CCGGGCAGAGTTCCAAGACAGGATACTCGAGTATCCTGTCTTGGAACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005271.1-665s1c1
Sequence:CCGGCCCAAGAACTATACTGATAATCTCGAGATTATCAGTATAGTTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005271.1-1721s1c1
Sequence:CCGGGCCATTGAGAAAGTCTTCAAACTCGAGTTTGAAGACTTTCTCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005271.1-1192s1c1
Sequence:CCGGGCCCTATGAAGGAAGCATCTTCTCGAGAAGATGCTTCCTTCATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005271.2-851s21c1
Sequence:CCGGCACGCCTGTGTTACTGGTAAACTCGAGTTTACCAGTAACACAGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005271.2-1642s21c1
Sequence:CCGGGCGTTCTGCCAGGCAAATTATCTCGAGATAATTTGCCTGGCAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343656    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005271.2-2217s21c1
Sequence:CCGGTCAAGTGAGTTCTTAGTATTTCTCGAGAAATACTAAGAACTCACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005271.2-1568s21c1
Sequence:CCGGGCAGAGTTCCAAGACAGGATACTCGAGTATCCTGTCTTGGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005271.2-1721s21c1
Sequence:CCGGGCCATTGAGAAAGTCTTCAAACTCGAGTTTGAAGACTTTCTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks