EMAIL THIS PAGE TO A FRIEND

GLUD2

glutamate dehydrogenase 2

31 Gene Product Result for
Synonyms: GDH2 GLUDP1
Species: Human GLUD2(2747)
UniProtKB ID: P49448, B2R8G0, Q9UDQ4
Gene ID:
Human(2747) Summary: The protein encoded by this gene is localized to the mitochondrion and acts as a homohexamer to recycle glutamate during neurotransmission. The encoded enzyme catalyzes the reversible oxidative deamination of glutamate to alpha-ketoglutarate. This gene is intronless.[provided by RefSeq, Jan 2010]
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012084 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012084 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012084 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110751 MISSION® esiRNA esiRNA human GLUD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012084 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044099 predicted 1771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012084
VALIDATED
GLUD2 MISSION shRNA Bacterial Glycerol Stock
glutamate dehydrogenase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_012084.3-1015s1c1
Sequence:CCGGGCCTACACTCTATGAGATATTCTCGAGAATATCTCATAGAGTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_012084.3-1441s1c1
Sequence:CCGGCCTTCAAATATGAAAGGGATTCTCGAGAATCCCTTTCATATTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012084.3-1686s1c1
Sequence:CCGGGCTGCCTATGTCAATGCCATTCTCGAGAATGGCATTGACATAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012084.3-701s1c1
Sequence:CCGGGCTAGCAAAGAAGGGCTTTATCTCGAGATAAAGCCCTTCTTTGCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_012084.3-1548s1c1
Sequence:CCGGGCAGAGTTCCAAGACAGTATACTCGAGTATACTGTCTTGGAACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012084
VALIDATED
GLUD2 MISSION shRNA shRNA Plasmid DNA
glutamate dehydrogenase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_012084.3-1015s1c1
Sequence:CCGGGCCTACACTCTATGAGATATTCTCGAGAATATCTCATAGAGTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_012084.3-1441s1c1
Sequence:CCGGCCTTCAAATATGAAAGGGATTCTCGAGAATCCCTTTCATATTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012084.3-1686s1c1
Sequence:CCGGGCTGCCTATGTCAATGCCATTCTCGAGAATGGCATTGACATAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012084.3-701s1c1
Sequence:CCGGGCTAGCAAAGAAGGGCTTTATCTCGAGATAAAGCCCTTCTTTGCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_012084.3-1548s1c1
Sequence:CCGGGCAGAGTTCCAAGACAGTATACTCGAGTATACTGTCTTGGAACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012084
VALIDATED
GLUD2 MISSION shRNA Lentiviral Transduction Particles
glutamate dehydrogenase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_012084.3-1015s1c1
Sequence:CCGGGCCTACACTCTATGAGATATTCTCGAGAATATCTCATAGAGTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_012084.3-1441s1c1
Sequence:CCGGCCTTCAAATATGAAAGGGATTCTCGAGAATCCCTTTCATATTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012084.3-1686s1c1
Sequence:CCGGGCTGCCTATGTCAATGCCATTCTCGAGAATGGCATTGACATAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012084.3-701s1c1
Sequence:CCGGGCTAGCAAAGAAGGGCTTTATCTCGAGATAAAGCCCTTCTTTGCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_012084.3-1548s1c1
Sequence:CCGGGCAGAGTTCCAAGACAGTATACTCGAGTATACTGTCTTGGAACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks