EMAIL THIS PAGE TO A FRIEND

GLUL

glutamate-ammonia ligase

163 Gene Product Result for
Synonyms: GLNS GS PIG43 PIG59
UniProtKB ID: P15104, Q499Y9, Q5T9Z1, Q7Z3W4, Q8IZ17
Gene ID:
Human(2752) Summary: The protein encoded by this gene belongs to the glutamine synthetase family. It catalyzes the synthesis of glutamine from glutamate and ammonia. Glutamine is a main source of energy and is involved in cell proliferation, inhibition of apoptosis, and cell signaling. This gene is expressed during early fetal stages, and plays an important role in controlling body pH by removing ammonia from circulation. Mutations in this gene are associated with congenital glutamine deficiency. Several alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2009]
Mouse(14645) glutamate-ammonia ligase (glutamine synthetase)
Rat(24957) glutamate-ammonia ligase
chicken(396489) glutamate-ammonia ligase
dog(403443) glutamate-ammonia ligase
Horse(100054716) glutamate-ammonia ligase
cow(281199) glutamate-ammonia ligase
domestic cat(101093325) glutamate-ammonia ligase
domestic guinea pig(100715062) glutamate-ammonia ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA007316 Anti-GLUL antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA007571 Anti-GLUL antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1408580 Anti-GLUL antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
western blot pricing
G2781 Anti-Glutamine Synthetase antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat
immunohistochemistry, microarray, western blot pricing
WH0002752M1 Monoclonal Anti-GLUL antibody produced in mouse clone 2B12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB4100358 Monoclonal Anti-GLUL antibody produced in mouse clone GLUL-A306, culture supernatant human
western blot pricing
SAB4100359 Monoclonal Anti-GLUL antibody produced in mouse clone GLUL-B306, culture supernatant human
western blot pricing
SAB4100360 Monoclonal Anti-GLUL antibody produced in mouse clone GLUL-C306, culture supernatant human
western blot pricing
AMAB91101 Monoclonal Anti-GLUL antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2999, purified immunoglobulin, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
AMAB91102 Monoclonal Anti-GLUL antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3004, purified immunoglobulin, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
AMAB91103 Monoclonal Anti-GLUL antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3013, purified immunoglobulin, buffered aqueous glycerol solution rat, mouse, human
immunohistochemistry, western blot pricing
SAB1403872 Monoclonal Anti-GLUL, (C-terminal) antibody produced in mouse clone 3B6, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
H2775 DL-threo-β-Hydroxyaspartic acid human, mouse pricing
A7275 L-2-Aminoadipic acid ≥98% (TLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002065 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002065 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002065 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008131 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008131 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008131 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033044 Rosetta Predictions human pricing
NM_001033056 Rosetta Predictions human pricing
NM_002065 Rosetta Predictions human pricing
NM_017073 Rosetta Predictions rat pricing
NM_008131 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307974 predicted 756
2 SASI_Hs01_00065905 predicted 693
3 SASI_Hs01_00065906 predicted 680
4 SASI_Hs01_00065907 predicted 496
5 SASI_Hs01_00065909 predicted 356
6 SASI_Hs01_00065910 predicted 1350
7 SASI_Hs01_00065911 predicted 1268
8 SASI_Hs01_00065912 predicted 1043
9 SASI_Hs01_00065913 predicted 477
10 SASI_Hs01_00065914 predicted 1096
11 SASI_Hs01_00065908 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307993 predicted 824
2 SASI_Hs01_00242658 predicted 752
3 SASI_Hs01_00242659 predicted 742
4 SASI_Hs01_00242660 predicted 564
5 SASI_Hs01_00242662 predicted 423
6 SASI_Hs01_00242663 predicted 1419
7 SASI_Hs01_00242664 predicted 1331
8 SASI_Hs01_00242665 predicted 1098
9 SASI_Hs01_00242666 predicted 539
10 SASI_Hs01_00242667 predicted 1160
11 SASI_Hs01_00242661 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333134 predicted 1111
2 SASI_Hs01_00065725 predicted 1053
3 SASI_Hs01_00065726 predicted 1033
4 SASI_Hs01_00065727 predicted 858
5 SASI_Hs01_00065729 predicted 718
6 SASI_Hs01_00065730 predicted 1705
7 SASI_Hs01_00065731 predicted 1628
8 SASI_Hs01_00065732 predicted 1399
9 SASI_Hs01_00065733 predicted 829
10 SASI_Hs01_00065734 predicted 1453
11 SASI_Hs01_00065728 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017073 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083421 predicted 519
2 SASI_Rn02_00261279 predicted 1327
3 SASI_Rn02_00261280 predicted 599
4 SASI_Rn02_00261281 predicted 628
5 SASI_Rn02_00261282 predicted 649
6 SASI_Rn01_00083424 predicted 666
7 SASI_Rn01_00083428 predicted 291
8 SASI_Rn01_00083429 predicted 467
9 SASI_Rn01_00083430 predicted 300
10 SASI_Rn02_00261283 predicted 931
11 SASI_Rn01_00083422 predicted 2922
12 SASI_Rn01_00083423 predicted 2956
13 SASI_Rn01_00083425 predicted 2801
14 SASI_Rn01_00083426 predicted 2828
15 SASI_Rn01_00083427 predicted 2824
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044456 predicted 671
2 SASI_Mm02_00313191 predicted 652
3 SASI_Mm02_00313192 predicted 561
4 SASI_Mm02_00313193 predicted 557
5 SASI_Mm02_00313194 predicted 475
6 SASI_Mm02_00313195 predicted 459
7 SASI_Mm01_00044455 predicted 353
8 SASI_Mm02_00313196 predicted 466
9 SASI_Mm02_00313197 predicted 704
10 SASI_Mm02_00313198 predicted 879
11 SASI_Mm01_00044449 predicted 854
12 SASI_Mm01_00044450 predicted 366
13 SASI_Mm01_00044451 predicted 1022
14 SASI_Mm01_00044452 predicted 557
15 SASI_Mm01_00044453 predicted 551
16 SASI_Mm01_00044454 predicted 241
17 SASI_Mm01_00044457 predicted 468
18 SASI_Mm01_00044458 predicted 771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002065
VALIDATED
GLUL MISSION shRNA Bacterial Glycerol Stock
glutamate-ammonia ligase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_002065.3-802s1c1
Sequence:CCGGGCACACCTGTAAACGGATAATCTCGAGATTATCCGTTTACAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_002065.3-1135s1c1
Sequence:CCGGGCATCGTGTGTGTGAAGACTTCTCGAGAAGTCTTCACACACACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_002065.3-1450s1c1
Sequence:CCGGCCAGGAGAAGAAGGGTTACTTCTCGAGAAGTAACCCTTCTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_002065.3-734s1c1
Sequence:CCGGGACCCTAACAAGCTGGTGTTACTCGAGTAACACCAGCTTGTTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002065.3-542s1c1
Sequence:CCGGGCCATGTATATCTGGATCGATCTCGAGATCGATCCAGATATACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002065.4-578s21c1
Sequence:CCGGGAAAGTCCAGGCCATGTATATCTCGAGATATACATGGCCTGGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002065.4-690s21c1
Sequence:CCGGTTCGATGGCTCTAGTACTTTACTCGAGTAAAGTACTAGAGCCATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002065.4-849s21c1
Sequence:CCGGCACACCTGTAAACGGATAATGCTCGAGCATTATCCGTTTACAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002065.4-1890s21c1
Sequence:CCGGATAACCACTGCTTCCATTTAACTCGAGTTAAATGGAAGCAGTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002065.4-1498s21c1
Sequence:CCGGAGGAGAAGAAGGGTTACTTTGCTCGAGCAAAGTAACCCTTCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002065
VALIDATED
GLUL MISSION shRNA shRNA Plasmid DNA
glutamate-ammonia ligase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_002065.3-802s1c1
Sequence:CCGGGCACACCTGTAAACGGATAATCTCGAGATTATCCGTTTACAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_002065.3-1135s1c1
Sequence:CCGGGCATCGTGTGTGTGAAGACTTCTCGAGAAGTCTTCACACACACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_002065.3-1450s1c1
Sequence:CCGGCCAGGAGAAGAAGGGTTACTTCTCGAGAAGTAACCCTTCTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_002065.3-734s1c1
Sequence:CCGGGACCCTAACAAGCTGGTGTTACTCGAGTAACACCAGCTTGTTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002065.3-542s1c1
Sequence:CCGGGCCATGTATATCTGGATCGATCTCGAGATCGATCCAGATATACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002065.4-578s21c1
Sequence:CCGGGAAAGTCCAGGCCATGTATATCTCGAGATATACATGGCCTGGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002065.4-690s21c1
Sequence:CCGGTTCGATGGCTCTAGTACTTTACTCGAGTAAAGTACTAGAGCCATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002065.4-849s21c1
Sequence:CCGGCACACCTGTAAACGGATAATGCTCGAGCATTATCCGTTTACAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002065.4-1890s21c1
Sequence:CCGGATAACCACTGCTTCCATTTAACTCGAGTTAAATGGAAGCAGTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002065.4-1498s21c1
Sequence:CCGGAGGAGAAGAAGGGTTACTTTGCTCGAGCAAAGTAACCCTTCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002065
VALIDATED
GLUL MISSION shRNA Lentiviral Transduction Particles
glutamate-ammonia ligase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_002065.3-802s1c1
Sequence:CCGGGCACACCTGTAAACGGATAATCTCGAGATTATCCGTTTACAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_002065.3-1135s1c1
Sequence:CCGGGCATCGTGTGTGTGAAGACTTCTCGAGAAGTCTTCACACACACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_002065.3-1450s1c1
Sequence:CCGGCCAGGAGAAGAAGGGTTACTTCTCGAGAAGTAACCCTTCTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_002065.3-734s1c1
Sequence:CCGGGACCCTAACAAGCTGGTGTTACTCGAGTAACACCAGCTTGTTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002065.3-542s1c1
Sequence:CCGGGCCATGTATATCTGGATCGATCTCGAGATCGATCCAGATATACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002065.4-578s21c1
Sequence:CCGGGAAAGTCCAGGCCATGTATATCTCGAGATATACATGGCCTGGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002065.4-690s21c1
Sequence:CCGGTTCGATGGCTCTAGTACTTTACTCGAGTAAAGTACTAGAGCCATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002065.4-849s21c1
Sequence:CCGGCACACCTGTAAACGGATAATGCTCGAGCATTATCCGTTTACAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002065.4-1890s21c1
Sequence:CCGGATAACCACTGCTTCCATTTAACTCGAGTTAAATGGAAGCAGTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002065.4-1498s21c1
Sequence:CCGGAGGAGAAGAAGGGTTACTTTGCTCGAGCAAAGTAACCCTTCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008131
GLUL MISSION shRNA Bacterial Glycerol Stock
glutamate-ammonia ligase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008131.2-1530s1c1
Sequence:CCGGGCGGGTGTACTTATGGTGAAACTCGAGTTTCACCATAAGTACACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008131.2-1226s1c1
Sequence:CCGGCGAACCCTTCCAATACAAGAACTCGAGTTCTTGTATTGGAAGGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008131.2-467s1c1
Sequence:CCGGGAGGCACATCTGTAAACGGATCTCGAGATCCGTTTACAGATGTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008131.2-210s1c1
Sequence:CCGGGCCATGTATATCTGGGTTGATCTCGAGATCAACCCAGATATACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008131.2-884s1c1
Sequence:CCGGCCATACCAACTTCAGCACCAACTCGAGTTGGTGCTGAAGTTGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008131.3-1530s21c1
Sequence:CCGGGCGGGTGTACTTATGGTGAAACTCGAGTTTCACCATAAGTACACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008131.3-210s21c1
Sequence:CCGGGCCATGTATATCTGGGTTGATCTCGAGATCAACCCAGATATACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008131.3-467s21c1
Sequence:CCGGGAGGCACATCTGTAAACGGATCTCGAGATCCGTTTACAGATGTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008131.3-1226s21c1
Sequence:CCGGCGAACCCTTCCAATACAAGAACTCGAGTTCTTGTATTGGAAGGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008131.3-884s21c1
Sequence:CCGGCCATACCAACTTCAGCACCAACTCGAGTTGGTGCTGAAGTTGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008131
GLUL MISSION shRNA shRNA Plasmid DNA
glutamate-ammonia ligase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008131.2-1530s1c1
Sequence:CCGGGCGGGTGTACTTATGGTGAAACTCGAGTTTCACCATAAGTACACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008131.2-1226s1c1
Sequence:CCGGCGAACCCTTCCAATACAAGAACTCGAGTTCTTGTATTGGAAGGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008131.2-467s1c1
Sequence:CCGGGAGGCACATCTGTAAACGGATCTCGAGATCCGTTTACAGATGTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008131.2-210s1c1
Sequence:CCGGGCCATGTATATCTGGGTTGATCTCGAGATCAACCCAGATATACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008131.2-884s1c1
Sequence:CCGGCCATACCAACTTCAGCACCAACTCGAGTTGGTGCTGAAGTTGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008131.3-1530s21c1
Sequence:CCGGGCGGGTGTACTTATGGTGAAACTCGAGTTTCACCATAAGTACACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008131.3-210s21c1
Sequence:CCGGGCCATGTATATCTGGGTTGATCTCGAGATCAACCCAGATATACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008131.3-467s21c1
Sequence:CCGGGAGGCACATCTGTAAACGGATCTCGAGATCCGTTTACAGATGTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008131.3-1226s21c1
Sequence:CCGGCGAACCCTTCCAATACAAGAACTCGAGTTCTTGTATTGGAAGGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008131.3-884s21c1
Sequence:CCGGCCATACCAACTTCAGCACCAACTCGAGTTGGTGCTGAAGTTGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008131
GLUL MISSION shRNA Lentiviral Transduction Particles
glutamate-ammonia ligase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008131.2-1530s1c1
Sequence:CCGGGCGGGTGTACTTATGGTGAAACTCGAGTTTCACCATAAGTACACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008131.2-1226s1c1
Sequence:CCGGCGAACCCTTCCAATACAAGAACTCGAGTTCTTGTATTGGAAGGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008131.2-467s1c1
Sequence:CCGGGAGGCACATCTGTAAACGGATCTCGAGATCCGTTTACAGATGTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008131.2-210s1c1
Sequence:CCGGGCCATGTATATCTGGGTTGATCTCGAGATCAACCCAGATATACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008131.2-884s1c1
Sequence:CCGGCCATACCAACTTCAGCACCAACTCGAGTTGGTGCTGAAGTTGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008131.3-1530s21c1
Sequence:CCGGGCGGGTGTACTTATGGTGAAACTCGAGTTTCACCATAAGTACACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008131.3-210s21c1
Sequence:CCGGGCCATGTATATCTGGGTTGATCTCGAGATCAACCCAGATATACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008131.3-467s21c1
Sequence:CCGGGAGGCACATCTGTAAACGGATCTCGAGATCCGTTTACAGATGTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008131.3-1226s21c1
Sequence:CCGGCGAACCCTTCCAATACAAGAACTCGAGTTCTTGTATTGGAAGGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008131.3-884s21c1
Sequence:CCGGCCATACCAACTTCAGCACCAACTCGAGTTGGTGCTGAAGTTGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks