EMAIL THIS PAGE TO A FRIEND

GLYAT

glycine-N-acyltransferase

186 Gene Product Result for
Synonyms: ACGNAT CAT GAT
UniProtKB ID: Q6IB77, O14833, Q96QK7
Gene ID:
Human(10249) Summary: The glycine-N-acyltransferase protein conjugates glycine with acyl-CoA substrates in the mitochondria. The protein is thought to be important in the detoxification of endogenous and xenobiotic acyl-CoA's. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(107146) glycine-N-acyltransferase
Rat(293779) glycine-N-acyltransferase
cow(281787) glycine-N-acyltransferase
Horse(100066603) glycine-N-acyltransferase
Horse(100068374) glycine-N-acyltransferase
domestic cat(101097840) glycine-N-acyltransferase
dog(483463) glycine-N-acyltransferase
sheep(101108685) glycine-N-acyltransferase
naked mole-rat(101713466) glycine-N-acyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005838 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005838 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005838 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145935 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145935 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145935 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134731 MISSION® esiRNA esiRNA human GLYAT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005838 Rosetta Predictions human pricing
NM_201648 Rosetta Predictions human pricing
NM_001009648 Rosetta Predictions rat pricing
NM_145935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233726 predicted 410
2 SASI_Hs01_00233727 predicted 262
3 SASI_Hs01_00233728 predicted 235
4 SASI_Hs01_00233729 predicted 367
5 SASI_Hs01_00233730 predicted 257
6 SASI_Hs02_00340371 predicted 316
7 SASI_Hs01_00233732 predicted 285
8 SASI_Hs02_00340372 predicted 415
9 SASI_Hs01_00233735 predicted 346
10 SASI_Hs02_00340373 predicted 263
11 SASI_Hs01_00233731 predicted 271
12 SASI_Hs01_00233733 predicted 409
13 SASI_Hs01_00233734 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088694 predicted 407
2 SASI_Hs01_00088695 predicted 261
3 SASI_Hs01_00088696 predicted 229
4 SASI_Hs01_00088697 predicted 364
5 SASI_Hs01_00088698 predicted 256
6 SASI_Hs02_00373151 predicted 320
7 SASI_Hs01_00088700 predicted 292
8 SASI_Hs02_00373152 predicted 416
9 SASI_Hs01_00088703 predicted 349
10 SASI_Hs02_00373153 predicted 257
11 SASI_Hs01_00088699 predicted 266
12 SASI_Hs01_00088701 predicted 416
13 SASI_Hs01_00088702 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199669 predicted 297
2 SASI_Rn01_00099039 predicted 532
3 SASI_Rn01_00099040 predicted 211
4 SASI_Rn01_00099044 predicted 489
5 SASI_Rn01_00099045 predicted 219
6 SASI_Rn02_00199670 predicted 428
7 SASI_Rn02_00199671 predicted 479
8 SASI_Rn02_00199672 predicted 357
9 SASI_Rn02_00199673 predicted 389
10 SASI_Rn02_00199674 predicted 465
11 SASI_Rn01_00099041 predicted 873
12 SASI_Rn01_00099042 predicted 980
13 SASI_Rn01_00099043 predicted 847
14 SASI_Rn01_00099046 predicted 864
15 SASI_Rn01_00099047 predicted 919
16 SASI_Rn01_00099048 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128718 predicted 327
2 SASI_Mm01_00128719 predicted 792
3 SASI_Mm01_00128720 predicted 1036
4 SASI_Mm01_00128721 predicted 710
5 SASI_Mm01_00128722 predicted 1086
6 SASI_Mm01_00128723 predicted 1071
7 SASI_Mm01_00128724 predicted 569
8 SASI_Mm01_00128725 predicted 796
9 SASI_Mm01_00128726 predicted 852
10 SASI_Mm02_00341389 predicted 635
11 SASI_Mm01_00128727 predicted 508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005838
GLYAT MISSION shRNA Bacterial Glycerol Stock
glycine-N-acyltransferase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005838.3-950s21c1
Sequence:CCGGAGGACTTCACATTTGTTATTTCTCGAGAAATAACAAATGTGAAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005838.3-925s21c1
Sequence:CCGGTTCATCACAAGCTCATCTATACTCGAGTATAGATGAGCTTGTGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005838.3-243s21c1
Sequence:CCGGGGAACTGTCTTTCACATAAACCTCGAGGTTTATGTGAAAGACAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005838.3-540s21c1
Sequence:CCGGACACAACGCATTCTCTATATGCTCGAGCATATAGAGAATGCGTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005838.2-221s1c1
Sequence:CCGGCCCAGCATCCTTAAAGGTTTACTCGAGTAAACCTTTAAGGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005838.2-582s1c1
Sequence:CCGGCTGACTCCTTTCCTGCTGAAACTCGAGTTTCAGCAGGAAAGGAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005838.2-432s1c1
Sequence:CCGGCCAGAACTCATCAACTGGAAACTCGAGTTTCCAGTTGATGAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005838.2-378s1c1
Sequence:CCGGACTTACCAAATCTACTCCAAACTCGAGTTTGGAGTAGATTTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005838.2-480s1c1
Sequence:CCGGCCTAGCCTGAATGAGGCTATACTCGAGTATAGCCTCATTCAGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005838
GLYAT MISSION shRNA shRNA Plasmid DNA
glycine-N-acyltransferase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005838.3-950s21c1
Sequence:CCGGAGGACTTCACATTTGTTATTTCTCGAGAAATAACAAATGTGAAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005838.3-925s21c1
Sequence:CCGGTTCATCACAAGCTCATCTATACTCGAGTATAGATGAGCTTGTGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005838.3-243s21c1
Sequence:CCGGGGAACTGTCTTTCACATAAACCTCGAGGTTTATGTGAAAGACAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005838.3-540s21c1
Sequence:CCGGACACAACGCATTCTCTATATGCTCGAGCATATAGAGAATGCGTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005838.2-221s1c1
Sequence:CCGGCCCAGCATCCTTAAAGGTTTACTCGAGTAAACCTTTAAGGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005838.2-582s1c1
Sequence:CCGGCTGACTCCTTTCCTGCTGAAACTCGAGTTTCAGCAGGAAAGGAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005838.2-432s1c1
Sequence:CCGGCCAGAACTCATCAACTGGAAACTCGAGTTTCCAGTTGATGAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005838.2-378s1c1
Sequence:CCGGACTTACCAAATCTACTCCAAACTCGAGTTTGGAGTAGATTTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005838.2-480s1c1
Sequence:CCGGCCTAGCCTGAATGAGGCTATACTCGAGTATAGCCTCATTCAGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005838
GLYAT MISSION shRNA Lentiviral Transduction Particles
glycine-N-acyltransferase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005838.3-950s21c1
Sequence:CCGGAGGACTTCACATTTGTTATTTCTCGAGAAATAACAAATGTGAAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005838.3-925s21c1
Sequence:CCGGTTCATCACAAGCTCATCTATACTCGAGTATAGATGAGCTTGTGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005838.3-243s21c1
Sequence:CCGGGGAACTGTCTTTCACATAAACCTCGAGGTTTATGTGAAAGACAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005838.3-540s21c1
Sequence:CCGGACACAACGCATTCTCTATATGCTCGAGCATATAGAGAATGCGTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005838.2-221s1c1
Sequence:CCGGCCCAGCATCCTTAAAGGTTTACTCGAGTAAACCTTTAAGGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005838.2-582s1c1
Sequence:CCGGCTGACTCCTTTCCTGCTGAAACTCGAGTTTCAGCAGGAAAGGAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005838.2-432s1c1
Sequence:CCGGCCAGAACTCATCAACTGGAAACTCGAGTTTCCAGTTGATGAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005838.2-378s1c1
Sequence:CCGGACTTACCAAATCTACTCCAAACTCGAGTTTGGAGTAGATTTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005838.2-480s1c1
Sequence:CCGGCCTAGCCTGAATGAGGCTATACTCGAGTATAGCCTCATTCAGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145935
VALIDATED
GLYAT MISSION shRNA Bacterial Glycerol Stock
glycine-N-acyltransferase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145935.3-1069s21c1
Sequence:CCGGGATTATGACAAAGCGTGGTTACTCGAGTAACCACGCTTTGTCATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145935.3-798s21c1
Sequence:CCGGCCATTGATCAAGACAAGTTTACTCGAGTAAACTTGTCTTGATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145935.3-641s21c1
Sequence:CCGGCACCTGAATAAGACGATACAACTCGAGTTGTATCGTCTTATTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145935.3-898s21c1
Sequence:CCGGATTCATTGAACGCTGCATAAACTCGAGTTTATGCAGCGTTCAATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145935.2-798s1c1
Sequence:CCGGGCCATTGATCAAGACAAGTTTCTCGAGAAACTTGTCTTGATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145935.2-799s1c1
Sequence:CCGGCCATTGATCAAGACAAGTTTACTCGAGTAAACTTGTCTTGATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145935.2-642s1c1
Sequence:CCGGCACCTGAATAAGACGATACAACTCGAGTTGTATCGTCTTATTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145935.2-1070s1c1
Sequence:CCGGGATTATGACAAAGCGTGGTTACTCGAGTAACCACGCTTTGTCATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145935.2-643s1c1
Sequence:CCGGACCTGAATAAGACGATACAAACTCGAGTTTGTATCGTCTTATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145935
VALIDATED
GLYAT MISSION shRNA shRNA Plasmid DNA
glycine-N-acyltransferase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145935.3-1069s21c1
Sequence:CCGGGATTATGACAAAGCGTGGTTACTCGAGTAACCACGCTTTGTCATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145935.3-798s21c1
Sequence:CCGGCCATTGATCAAGACAAGTTTACTCGAGTAAACTTGTCTTGATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145935.3-641s21c1
Sequence:CCGGCACCTGAATAAGACGATACAACTCGAGTTGTATCGTCTTATTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145935.3-898s21c1
Sequence:CCGGATTCATTGAACGCTGCATAAACTCGAGTTTATGCAGCGTTCAATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145935.2-798s1c1
Sequence:CCGGGCCATTGATCAAGACAAGTTTCTCGAGAAACTTGTCTTGATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145935.2-799s1c1
Sequence:CCGGCCATTGATCAAGACAAGTTTACTCGAGTAAACTTGTCTTGATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145935.2-642s1c1
Sequence:CCGGCACCTGAATAAGACGATACAACTCGAGTTGTATCGTCTTATTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145935.2-1070s1c1
Sequence:CCGGGATTATGACAAAGCGTGGTTACTCGAGTAACCACGCTTTGTCATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145935.2-643s1c1
Sequence:CCGGACCTGAATAAGACGATACAAACTCGAGTTTGTATCGTCTTATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145935
VALIDATED
GLYAT MISSION shRNA Lentiviral Transduction Particles
glycine-N-acyltransferase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145935.3-1069s21c1
Sequence:CCGGGATTATGACAAAGCGTGGTTACTCGAGTAACCACGCTTTGTCATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145935.3-798s21c1
Sequence:CCGGCCATTGATCAAGACAAGTTTACTCGAGTAAACTTGTCTTGATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145935.3-641s21c1
Sequence:CCGGCACCTGAATAAGACGATACAACTCGAGTTGTATCGTCTTATTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145935.3-898s21c1
Sequence:CCGGATTCATTGAACGCTGCATAAACTCGAGTTTATGCAGCGTTCAATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145935.2-798s1c1
Sequence:CCGGGCCATTGATCAAGACAAGTTTCTCGAGAAACTTGTCTTGATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145935.2-799s1c1
Sequence:CCGGCCATTGATCAAGACAAGTTTACTCGAGTAAACTTGTCTTGATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145935.2-642s1c1
Sequence:CCGGCACCTGAATAAGACGATACAACTCGAGTTGTATCGTCTTATTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145935.2-1070s1c1
Sequence:CCGGGATTATGACAAAGCGTGGTTACTCGAGTAACCACGCTTTGTCATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145935.2-643s1c1
Sequence:CCGGACCTGAATAAGACGATACAAACTCGAGTTTGTATCGTCTTATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks