EMAIL THIS PAGE TO A FRIEND

GLYATL1

glycine-N-acyltransferase-like 1

64 Gene Product Result for
Synonyms: GATF-C GNAT
Species: Human GLYATL1(92292)
UniProtKB ID: Q969I3, A6NDT0, Q7Z510, Q8NAW8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080661 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080661 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080661 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059061 MISSION® esiRNA esiRNA human GLYATL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080661 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193348 predicted 876
2 SASI_Hs01_00193349 predicted 876
3 SASI_Hs01_00193350 predicted 869
4 SASI_Hs01_00193351 predicted 1461
5 SASI_Hs01_00193352 predicted 688
6 SASI_Hs01_00193353 predicted 552
7 SASI_Hs01_00193354 predicted 857
8 SASI_Hs02_00362422 predicted 760
9 SASI_Hs01_00193355 predicted 1494
10 SASI_Hs01_00193356 predicted 1472
11 SASI_Hs01_00193357 predicted 1540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080661
GLYATL1 MISSION shRNA Bacterial Glycerol Stock
glycine-N-acyltransferase-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080661.2-326s1c1
Sequence:CCGGGCAGGAGATGACTGATGACATCTCGAGATGTCATCAGTCATCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080661.2-362s1c1
Sequence:CCGGCGTATATCGTATGTTCTCCAACTCGAGTTGGAGAACATACGATATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158569    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080661.2-1432s1c1
Sequence:CCGGCCTAATCTGTATGGATACTTTCTCGAGAAAGTATCCATACAGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080661.2-537s1c1
Sequence:CCGGCTCTTGGTTACGGAAGATATTCTCGAGAATATCTTCCGTAACCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080661.2-683s1c1
Sequence:CCGGGCTGGTAAATGACAACTGGAACTCGAGTTCCAGTTGTCATTTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080661.2-909s1c1
Sequence:CCGGCGTCAGAAGAATATTCCATTTCTCGAGAAATGGAATATTCTTCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080661.2-224s1c1
Sequence:CCGGGTATGGCTCTGTGTATCACATCTCGAGATGTGATACACAGAGCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080661.2-1366s21c1
Sequence:CCGGTGGTTAATAGAATCTACTATCCTCGAGGATAGTAGATTCTATTAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080661.2-184s21c1
Sequence:CCGGGGCTGAGGATAATAGAGTTTCCTCGAGGAAACTCTATTATCCTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080661.2-1487s21c1
Sequence:CCGGATGAGGCAATGGTACACTAAACTCGAGTTTAGTGTACCATTGCCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080661
GLYATL1 MISSION shRNA shRNA Plasmid DNA
glycine-N-acyltransferase-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080661.2-326s1c1
Sequence:CCGGGCAGGAGATGACTGATGACATCTCGAGATGTCATCAGTCATCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080661.2-362s1c1
Sequence:CCGGCGTATATCGTATGTTCTCCAACTCGAGTTGGAGAACATACGATATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158569    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080661.2-1432s1c1
Sequence:CCGGCCTAATCTGTATGGATACTTTCTCGAGAAAGTATCCATACAGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080661.2-537s1c1
Sequence:CCGGCTCTTGGTTACGGAAGATATTCTCGAGAATATCTTCCGTAACCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080661.2-683s1c1
Sequence:CCGGGCTGGTAAATGACAACTGGAACTCGAGTTCCAGTTGTCATTTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080661.2-909s1c1
Sequence:CCGGCGTCAGAAGAATATTCCATTTCTCGAGAAATGGAATATTCTTCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080661.2-224s1c1
Sequence:CCGGGTATGGCTCTGTGTATCACATCTCGAGATGTGATACACAGAGCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080661.2-1366s21c1
Sequence:CCGGTGGTTAATAGAATCTACTATCCTCGAGGATAGTAGATTCTATTAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080661.2-184s21c1
Sequence:CCGGGGCTGAGGATAATAGAGTTTCCTCGAGGAAACTCTATTATCCTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080661.2-1487s21c1
Sequence:CCGGATGAGGCAATGGTACACTAAACTCGAGTTTAGTGTACCATTGCCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080661
GLYATL1 MISSION shRNA Lentiviral Transduction Particles
glycine-N-acyltransferase-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080661.2-326s1c1
Sequence:CCGGGCAGGAGATGACTGATGACATCTCGAGATGTCATCAGTCATCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080661.2-362s1c1
Sequence:CCGGCGTATATCGTATGTTCTCCAACTCGAGTTGGAGAACATACGATATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158569    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080661.2-1432s1c1
Sequence:CCGGCCTAATCTGTATGGATACTTTCTCGAGAAAGTATCCATACAGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080661.2-537s1c1
Sequence:CCGGCTCTTGGTTACGGAAGATATTCTCGAGAATATCTTCCGTAACCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080661.2-683s1c1
Sequence:CCGGGCTGGTAAATGACAACTGGAACTCGAGTTCCAGTTGTCATTTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080661.2-909s1c1
Sequence:CCGGCGTCAGAAGAATATTCCATTTCTCGAGAAATGGAATATTCTTCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080661.2-224s1c1
Sequence:CCGGGTATGGCTCTGTGTATCACATCTCGAGATGTGATACACAGAGCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080661.2-1366s21c1
Sequence:CCGGTGGTTAATAGAATCTACTATCCTCGAGGATAGTAGATTCTATTAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080661.2-184s21c1
Sequence:CCGGGGCTGAGGATAATAGAGTTTCCTCGAGGAAACTCTATTATCCTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080661.2-1487s21c1
Sequence:CCGGATGAGGCAATGGTACACTAAACTCGAGTTTAGTGTACCATTGCCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks