EMAIL THIS PAGE TO A FRIEND

GLYATL2

glycine-N-acyltransferase-like 2

51 Gene Product Result for
Synonyms: BXMAS2-10 GATF-B
UniProtKB ID: Q8WU03, Q86WC3, Q96AT2
Gene ID:
Rat(171179) glycine-N-acyltransferase-like 2
domestic cat(101094699) glycine-N-acyltransferase-like 2
cow(515352) glycine-N-acyltransferase-like 2
sheep(101109387) glycine-N-acyltransferase-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145016 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145016 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145016 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053081 MISSION® esiRNA esiRNA human GLYATL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145016 Rosetta Predictions human pricing
NM_134330 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123550 predicted 1102
2 SASI_Hs01_00123551 predicted 1073
3 SASI_Hs01_00123552 predicted 465
4 SASI_Hs01_00123553 predicted 347
5 SASI_Hs01_00123554 predicted 519
6 SASI_Hs02_00364866 predicted 525
7 SASI_Hs01_00123555 predicted 1107
8 SASI_Hs02_00364867 predicted 754
9 SASI_Hs01_00123558 predicted 460
10 SASI_Hs02_00364868 predicted 1066
11 SASI_Hs01_00123549 predicted 1263
12 SASI_Hs01_00123556 predicted 843
13 SASI_Hs01_00123557 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063755 predicted 433
2 SASI_Rn02_00267874 predicted 501
3 SASI_Rn01_00063759 predicted 332
4 SASI_Rn01_00063757 predicted 413
5 SASI_Rn01_00063760 predicted 255
6 SASI_Rn02_00267875 predicted 700
7 SASI_Rn01_00063762 predicted 396
8 SASI_Rn01_00063763 predicted 983
9 SASI_Rn01_00063764 predicted 834
10 SASI_Rn02_00267876 predicted 264
11 SASI_Rn01_00063756 predicted 525
12 SASI_Rn01_00063758 predicted 786
13 SASI_Rn01_00063761 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145016
GLYATL2 MISSION shRNA Bacterial Glycerol Stock
glycine-N-acyltransferase-like 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145016.3-366s21c1
Sequence:CCGGACCAAAGCTCCTGACAAATTACTCGAGTAATTTGTCAGGAGCTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145016.3-280s21c1
Sequence:CCGGCAGATTACCAGATCGTCATTACTCGAGTAATGACGATCTGGTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145016.3-1118s21c1
Sequence:CCGGTAGGATCTGTGTATTACTTAACTCGAGTTAAGTAATACACAGATCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145016.3-522s21c1
Sequence:CCGGATCCTCTTTATACCGGAATTACTCGAGTAATTCCGGTATAAAGAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145016.2-1021s1c1
Sequence:CCGGGCTTGTCTCTTGGATTGTGATCTCGAGATCACAATCCAAGAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145016.2-463s1c1
Sequence:CCGGCATAAAGGTATATGGCGCCATCTCGAGATGGCGCCATATACCTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147939    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145016.2-1279s1c1
Sequence:CCGGGATTCCACTGTCCATTTCAAACTCGAGTTTGAAATGGACAGTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146311    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145016.2-1333s1c1
Sequence:CCGGCACAAGCATTGTGATCTACATCTCGAGATGTAGATCACAATGCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145016.2-655s1c1
Sequence:CCGGCCTGTCATACTCCAATGTAATCTCGAGATTACATTGGAGTATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145016.2-1283s1c1
Sequence:CCGGCCACTGTCCATTTCAAATCTTCTCGAGAAGATTTGAAATGGACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145016.2-717s1c1
Sequence:CCGGGCTTGGATGAAGCAATAAGAACTCGAGTTCTTATTGCTTCATCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145016
GLYATL2 MISSION shRNA shRNA Plasmid DNA
glycine-N-acyltransferase-like 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145016.3-366s21c1
Sequence:CCGGACCAAAGCTCCTGACAAATTACTCGAGTAATTTGTCAGGAGCTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145016.3-280s21c1
Sequence:CCGGCAGATTACCAGATCGTCATTACTCGAGTAATGACGATCTGGTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145016.3-1118s21c1
Sequence:CCGGTAGGATCTGTGTATTACTTAACTCGAGTTAAGTAATACACAGATCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145016.3-522s21c1
Sequence:CCGGATCCTCTTTATACCGGAATTACTCGAGTAATTCCGGTATAAAGAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145016.2-1021s1c1
Sequence:CCGGGCTTGTCTCTTGGATTGTGATCTCGAGATCACAATCCAAGAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145016.2-463s1c1
Sequence:CCGGCATAAAGGTATATGGCGCCATCTCGAGATGGCGCCATATACCTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147939    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145016.2-1279s1c1
Sequence:CCGGGATTCCACTGTCCATTTCAAACTCGAGTTTGAAATGGACAGTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146311    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145016.2-1333s1c1
Sequence:CCGGCACAAGCATTGTGATCTACATCTCGAGATGTAGATCACAATGCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145016.2-655s1c1
Sequence:CCGGCCTGTCATACTCCAATGTAATCTCGAGATTACATTGGAGTATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145016.2-1283s1c1
Sequence:CCGGCCACTGTCCATTTCAAATCTTCTCGAGAAGATTTGAAATGGACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145016.2-717s1c1
Sequence:CCGGGCTTGGATGAAGCAATAAGAACTCGAGTTCTTATTGCTTCATCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145016
GLYATL2 MISSION shRNA Lentiviral Transduction Particles
glycine-N-acyltransferase-like 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145016.3-366s21c1
Sequence:CCGGACCAAAGCTCCTGACAAATTACTCGAGTAATTTGTCAGGAGCTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145016.3-280s21c1
Sequence:CCGGCAGATTACCAGATCGTCATTACTCGAGTAATGACGATCTGGTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145016.3-1118s21c1
Sequence:CCGGTAGGATCTGTGTATTACTTAACTCGAGTTAAGTAATACACAGATCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145016.3-522s21c1
Sequence:CCGGATCCTCTTTATACCGGAATTACTCGAGTAATTCCGGTATAAAGAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145016.2-1021s1c1
Sequence:CCGGGCTTGTCTCTTGGATTGTGATCTCGAGATCACAATCCAAGAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145016.2-463s1c1
Sequence:CCGGCATAAAGGTATATGGCGCCATCTCGAGATGGCGCCATATACCTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147939    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145016.2-1279s1c1
Sequence:CCGGGATTCCACTGTCCATTTCAAACTCGAGTTTGAAATGGACAGTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146311    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145016.2-1333s1c1
Sequence:CCGGCACAAGCATTGTGATCTACATCTCGAGATGTAGATCACAATGCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145016.2-655s1c1
Sequence:CCGGCCTGTCATACTCCAATGTAATCTCGAGATTACATTGGAGTATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145016.2-1283s1c1
Sequence:CCGGCCACTGTCCATTTCAAATCTTCTCGAGAAGATTTGAAATGGACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145016.2-717s1c1
Sequence:CCGGGCTTGGATGAAGCAATAAGAACTCGAGTTCTTATTGCTTCATCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks