EMAIL THIS PAGE TO A FRIEND

GLYATL3

glycine-N-acyltransferase-like 3

67 Gene Product Result for
Synonyms: C6orf140 bA28H17.2
UniProtKB ID: Q5SZD4
Gene ID:
Mouse(435528) glycine-N-acyltransferase-like 3
Rat(688536) glycine-N-acyltransferase-like 3
sheep(101123590) glycine-N-acyltransferase-like 3
domestic guinea pig(100726471) glycine-N-acyltransferase-like 3
naked mole-rat(101715973) glycine-N-acyltransferase-like 3
cow(787783) glycine-N-acyltransferase-like 3
dog(610094) glycine N-acyltransferase-like protein 3-like
domestic cat(101093106) glycine-N-acyltransferase-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145060 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001145060 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001145060 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001010904 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010904 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010904 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717222 Rosetta Predictions human pricing
XM_371825 Rosetta Predictions human pricing
XM_001067325 Rosetta Predictions rat pricing
XM_487484 Rosetta Predictions mouse pricing
XM_909929 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00415832 predicted 300
2 SASI_Hs02_00415833 predicted 291
3 SASI_Hs02_00415834 predicted 461
4 SASI_Hs02_00415835 predicted 350
5 SASI_Hs02_00415836 predicted 479
6 SASI_Hs02_00415837 predicted 256
7 SASI_Hs02_00415838 predicted 476
8 SASI_Hs02_00415839 predicted 322
9 SASI_Hs02_00415840 predicted 417
10 SASI_Hs02_00415841 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479360 predicted 297
2 SASI_Hs02_00479361 predicted 290
3 SASI_Hs02_00479362 predicted 464
4 SASI_Hs02_00479363 predicted 345
5 SASI_Hs02_00479364 predicted 487
6 SASI_Hs02_00479365 predicted 256
7 SASI_Hs02_00479366 predicted 476
8 SASI_Hs02_00479367 predicted 322
9 SASI_Hs02_00479368 predicted 418
10 SASI_Hs02_00479369 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320685 predicted 325
2 SASI_Rn02_00320686 predicted 332
3 SASI_Rn02_00320687 predicted 670
4 SASI_Rn02_00320688 predicted 512
5 SASI_Rn02_00320689 predicted 283
6 SASI_Rn02_00320690 predicted 604
7 SASI_Rn02_00320691 predicted 683
8 SASI_Rn02_00320692 predicted 345
9 SASI_Rn02_00320693 predicted 392
10 SASI_Rn02_00320694 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_487484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426977 predicted 202
2 SASI_Mm02_00426978 predicted 292
3 SASI_Mm02_00426979 predicted 246
4 SASI_Mm01_00254317 predicted 513
5 SASI_Mm02_00426980 predicted 203
6 SASI_Mm01_00254320 predicted 426
7 SASI_Mm02_00426981 predicted 234
8 SASI_Mm01_00254321 predicted 365
9 SASI_Mm02_00426982 predicted 197
10 SASI_Mm01_00254323 predicted 357
11 SASI_Mm01_00254315 predicted 219
12 SASI_Mm01_00254316 predicted 222
13 SASI_Mm01_00254318 predicted 383
14 SASI_Mm01_00254319 predicted 302
15 SASI_Mm01_00254322 predicted 459
16 SASI_Mm01_00254324 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_909929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435193 predicted 205
2 SASI_Mm02_00435194 predicted 290
3 SASI_Mm02_00435195 predicted 249
4 SASI_Mm02_00435196 predicted 512
5 SASI_Mm02_00435197 predicted 200
6 SASI_Mm02_00435198 predicted 429
7 SASI_Mm02_00435199 predicted 230
8 SASI_Mm02_00435200 predicted 356
9 SASI_Mm02_00435201 predicted 196
10 SASI_Mm02_00435202 predicted 355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145060
GLYATL3 MISSION shRNA Bacterial Glycerol Stock
glycine-N-acyltransferase-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145060.1-363s21c1
Sequence:CCGGGCTGTTAGATTTGGATATAAACTCGAGTTTATATCCAAATCTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145060.1-266s21c1
Sequence:CCGGTGGAAGAACATGATGTTATTACTCGAGTAATAACATCATGTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145060.1-205s21c1
Sequence:CCGGGACCATTACACTAATGCATATCTCGAGATATGCATTAGTGTAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145060.1-94s21c1
Sequence:CCGGATGAACATAAATCGTGGAAATCTCGAGATTTCCACGATTTATGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145060.1-313s21c1
Sequence:CCGGGGGTTGCAAAGTGAATTATATCTCGAGATATAATTCACTTTGCAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145060
GLYATL3 MISSION shRNA shRNA Plasmid DNA
glycine-N-acyltransferase-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145060.1-363s21c1
Sequence:CCGGGCTGTTAGATTTGGATATAAACTCGAGTTTATATCCAAATCTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145060.1-266s21c1
Sequence:CCGGTGGAAGAACATGATGTTATTACTCGAGTAATAACATCATGTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145060.1-205s21c1
Sequence:CCGGGACCATTACACTAATGCATATCTCGAGATATGCATTAGTGTAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145060.1-94s21c1
Sequence:CCGGATGAACATAAATCGTGGAAATCTCGAGATTTCCACGATTTATGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145060.1-313s21c1
Sequence:CCGGGGGTTGCAAAGTGAATTATATCTCGAGATATAATTCACTTTGCAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145060
GLYATL3 MISSION shRNA Lentiviral Transduction Particles
glycine-N-acyltransferase-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145060.1-363s21c1
Sequence:CCGGGCTGTTAGATTTGGATATAAACTCGAGTTTATATCCAAATCTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145060.1-266s21c1
Sequence:CCGGTGGAAGAACATGATGTTATTACTCGAGTAATAACATCATGTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145060.1-205s21c1
Sequence:CCGGGACCATTACACTAATGCATATCTCGAGATATGCATTAGTGTAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145060.1-94s21c1
Sequence:CCGGATGAACATAAATCGTGGAAATCTCGAGATTTCCACGATTTATGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145060.1-313s21c1
Sequence:CCGGGGGTTGCAAAGTGAATTATATCTCGAGATATAATTCACTTTGCAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010904
GLYATL3 MISSION shRNA Bacterial Glycerol Stock
glycine-N-acyltransferase-like 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010904.1-1378s21c1
Sequence:CCGGTTCCCTACTGCCATCATATTCCTCGAGGAATATGATGGCAGTAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010904.1-921s21c1
Sequence:CCGGTGTCGCTTCCACAGGCTTATTCTCGAGAATAAGCCTGTGGAAGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010904.1-196s21c1
Sequence:CCGGACGGAGCGGTGATGAACATAACTCGAGTTATGTTCATCACCGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010904.1-275s21c1
Sequence:CCGGTGTTATCACCCGACGACAAAGCTCGAGCTTTGTCGTCGGGTGATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010904.1-864s21c1
Sequence:CCGGGATGACAACACGGCGTCTATACTCGAGTATAGACGCCGTGTTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010904
GLYATL3 MISSION shRNA shRNA Plasmid DNA
glycine-N-acyltransferase-like 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010904.1-1378s21c1
Sequence:CCGGTTCCCTACTGCCATCATATTCCTCGAGGAATATGATGGCAGTAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010904.1-921s21c1
Sequence:CCGGTGTCGCTTCCACAGGCTTATTCTCGAGAATAAGCCTGTGGAAGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010904.1-196s21c1
Sequence:CCGGACGGAGCGGTGATGAACATAACTCGAGTTATGTTCATCACCGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010904.1-275s21c1
Sequence:CCGGTGTTATCACCCGACGACAAAGCTCGAGCTTTGTCGTCGGGTGATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010904.1-864s21c1
Sequence:CCGGGATGACAACACGGCGTCTATACTCGAGTATAGACGCCGTGTTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010904
GLYATL3 MISSION shRNA Lentiviral Transduction Particles
glycine-N-acyltransferase-like 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010904.1-1378s21c1
Sequence:CCGGTTCCCTACTGCCATCATATTCCTCGAGGAATATGATGGCAGTAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010904.1-921s21c1
Sequence:CCGGTGTCGCTTCCACAGGCTTATTCTCGAGAATAAGCCTGTGGAAGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010904.1-196s21c1
Sequence:CCGGACGGAGCGGTGATGAACATAACTCGAGTTATGTTCATCACCGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010904.1-275s21c1
Sequence:CCGGTGTTATCACCCGACGACAAAGCTCGAGCTTTGTCGTCGGGTGATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010904.1-864s21c1
Sequence:CCGGGATGACAACACGGCGTCTATACTCGAGTATAGACGCCGTGTTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks