EMAIL THIS PAGE TO A FRIEND

GLYCAM1

glycosylation dependent cell adhesion molecule 1 (pseudogene)

39 Gene Product Result for
UniProtKB ID: Q8IVK1, Q8IUA8
Gene ID:
Mouse(14663) glycosylation dependent cell adhesion molecule 1
Rat(25258) glycosylation dependent cell adhesion molecule 1
cow(282430) glycosylation-dependent cell adhesion molecule 1
Goat(100860769) glycosylation-dependent cell adhesion molecule-1
sheep(100170329) glycosylation-dependant cell adhesion molecule 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008134 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008134 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008134 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_003039 Rosetta Predictions human pricing
NM_012794 Rosetta Predictions rat pricing
NM_008134 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00377844 predicted 358
2 SASI_Hs02_00377845 predicted 239
3 SASI_Hs02_00377846 predicted 477
4 SASI_Hs02_00377847 predicted 272
5 SASI_Hs02_00377848 predicted 481
6 SASI_Hs02_00377849 predicted 378
7 SASI_Hs02_00377850 predicted 546
8 SASI_Hs02_00377851 predicted 266
9 SASI_Hs02_00377852 predicted 483
10 SASI_Hs02_00377853 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012794 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121038 predicted 239
2 SASI_Rn01_00121039 predicted 316
3 SASI_Rn01_00121040 predicted 196
4 SASI_Rn01_00121041 predicted 216
5 SASI_Rn02_00260218 predicted 355
6 SASI_Rn01_00121042 predicted 311
7 SASI_Rn02_00260219 predicted 321
8 SASI_Rn01_00121044 predicted 274
9 SASI_Rn02_00260220 predicted 359
10 SASI_Rn01_00121047 predicted 280
11 SASI_Rn01_00121043 predicted 249
12 SASI_Rn01_00121045 predicted 288
13 SASI_Rn01_00121046 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313202 predicted 362
2 SASI_Mm02_00313203 predicted 390
3 SASI_Mm02_00313204 predicted 259
4 SASI_Mm02_00313205 predicted 260
5 SASI_Mm02_00313206 predicted 240
6 SASI_Mm02_00313207 predicted 249
7 SASI_Mm02_00313208 predicted 272
8 SASI_Mm02_00313209 predicted 367
9 SASI_Mm02_00313210 predicted 230
10 SASI_Mm02_00313211 predicted 225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008134
GLYCAM1 MISSION shRNA Bacterial Glycerol Stock
glycosylation dependent cell adhesion molecule 1 (pseudogene)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008134.1-239s1c1
Sequence:CCGGTCTTCAGAGAAGAGCTGATTTCTCGAGAAATCAGCTCTTCTCTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008134.1-203s1c1
Sequence:CCGGGTACTTCCAGTAAGGACCTTTCTCGAGAAAGGTCCTTACTGGAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008134.1-109s1c1
Sequence:CCGGCCTGGGTCCAAAGATGAACTTCTCGAGAAGTTCATCTTTGGACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008134.1-279s1c1
Sequence:CCGGAGAATCTACCAAGCCAGAGAACTCGAGTTCTCTGGCTTGGTAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008134.1-442s1c1
Sequence:CCGGGAAGGATTTGTAACTGGTGCACTCGAGTGCACCAGTTACAAATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008134
GLYCAM1 MISSION shRNA shRNA Plasmid DNA
glycosylation dependent cell adhesion molecule 1 (pseudogene)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008134.1-239s1c1
Sequence:CCGGTCTTCAGAGAAGAGCTGATTTCTCGAGAAATCAGCTCTTCTCTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008134.1-203s1c1
Sequence:CCGGGTACTTCCAGTAAGGACCTTTCTCGAGAAAGGTCCTTACTGGAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008134.1-109s1c1
Sequence:CCGGCCTGGGTCCAAAGATGAACTTCTCGAGAAGTTCATCTTTGGACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008134.1-279s1c1
Sequence:CCGGAGAATCTACCAAGCCAGAGAACTCGAGTTCTCTGGCTTGGTAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008134.1-442s1c1
Sequence:CCGGGAAGGATTTGTAACTGGTGCACTCGAGTGCACCAGTTACAAATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008134
GLYCAM1 MISSION shRNA Lentiviral Transduction Particles
glycosylation dependent cell adhesion molecule 1 (pseudogene)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008134.1-239s1c1
Sequence:CCGGTCTTCAGAGAAGAGCTGATTTCTCGAGAAATCAGCTCTTCTCTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008134.1-203s1c1
Sequence:CCGGGTACTTCCAGTAAGGACCTTTCTCGAGAAAGGTCCTTACTGGAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008134.1-109s1c1
Sequence:CCGGCCTGGGTCCAAAGATGAACTTCTCGAGAAGTTCATCTTTGGACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008134.1-279s1c1
Sequence:CCGGAGAATCTACCAAGCCAGAGAACTCGAGTTCTCTGGCTTGGTAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008134.1-442s1c1
Sequence:CCGGGAAGGATTTGTAACTGGTGCACTCGAGTGCACCAGTTACAAATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks