EMAIL THIS PAGE TO A FRIEND

GLYCTK

glycerate kinase

64 Gene Product Result for
Synonyms: HBEBP2 HBEBP4 HBeAgBP4A
Gene ID:
Human(132158) Summary: This locus encodes a member of the glycerate kinase type-2 family. The encoded enzyme catalyzes the phosphorylation of (R)-glycerate and may be involved in serine degradation and fructose metabolism. Decreased activity of the encoded enzyme may be associated with the disease D-glyceric aciduria. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009]
Mouse(235582) glycerate kinase
Rat(684314) glycerate kinase
Zebrafish(570678) glycerate kinase
chicken(427577) glycerate kinase
domestic cat(101081790) glycerate kinase
cow(507949) glycerate kinase
Horse(100060316) glycerate kinase
dog(484738) glycerate kinase
sheep(101111913) glycerate kinase
Domestic Rabbit(100346884) glycerate kinase
naked mole-rat(101705421) glycerate kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145262 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_174846 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174846 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174846 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU089861 MISSION® esiRNA esiRNA targeting mouse Glyctk (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145262 Rosetta Predictions human pricing
NM_001109449 Rosetta Predictions rat pricing
NM_001039586 Rosetta Predictions mouse pricing
NM_174846 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166767 predicted 1661
2 SASI_Hs02_00365131 predicted 830
3 SASI_Hs01_00166768 predicted 1374
4 SASI_Hs01_00166769 predicted 272
5 SASI_Hs01_00166770 predicted 382
6 SASI_Hs01_00166771 predicted 853
7 SASI_Hs02_00365132 predicted 275
8 SASI_Hs01_00166772 predicted 849
9 SASI_Hs01_00166773 predicted 1498
10 SASI_Hs01_00166774 predicted 858
11 SASI_Hs01_00166775 predicted 991
12 SASI_Hs01_00166776 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109449 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248517 predicted 1717
2 SASI_Rn02_00248518 predicted 871
3 SASI_Rn02_00248519 predicted 877
4 SASI_Rn02_00248520 predicted 782
5 SASI_Rn02_00248521 predicted 407
6 SASI_Rn02_00248522 predicted 996
7 SASI_Rn02_00248523 predicted 1605
8 SASI_Rn02_00248524 predicted 507
9 SASI_Rn02_00248525 predicted 301
10 SASI_Rn02_00248526 predicted 1589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102765 predicted 1055
2 SASI_Mm01_00102767 predicted 829
3 SASI_Mm01_00102768 predicted 1448
4 SASI_Mm02_00290167 predicted 847
5 SASI_Mm01_00102769 predicted 842
6 SASI_Mm01_00102770 predicted 1659
7 SASI_Mm01_00102774 predicted 1837
8 SASI_Mm02_00290168 predicted 2157
9 SASI_Mm02_00290169 predicted 1587
10 SASI_Mm02_00290170 predicted 1646
11 SASI_Mm01_00102766 predicted 359
12 SASI_Mm01_00102771 predicted 356
13 SASI_Mm01_00102772 predicted 573
14 SASI_Mm01_00102773 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173928 predicted 1188
2 SASI_Mm01_00173930 predicted 960
3 SASI_Mm01_00173931 predicted 1591
4 SASI_Mm02_00345490 predicted 982
5 SASI_Mm01_00173932 predicted 974
6 SASI_Mm01_00173933 predicted 1797
7 SASI_Mm01_00173937 predicted 1968
8 SASI_Mm02_00345491 predicted 2300
9 SASI_Mm02_00345492 predicted 1716
10 SASI_Mm02_00345493 predicted 1781
11 SASI_Mm01_00173929 predicted 495
12 SASI_Mm01_00173934 predicted 489
13 SASI_Mm01_00173935 predicted 702
14 SASI_Mm01_00173936 predicted 593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145262
VALIDATED
GLYCTK MISSION shRNA Bacterial Glycerol Stock
glycerate kinase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145262.2-861s1c1
Sequence:CCGGCCTGCATATCCTCAATCGCTACTCGAGTAGCGATTGAGGATATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145262.2-1510s1c1
Sequence:CCGGCTAGCCCACAATGACTCACATCTCGAGATGTGAGTCATTGTGGGCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145262.2-178s1c1
Sequence:CCGGCAGCTGTTTGAGAGTGCTGTACTCGAGTACAGCACTCTCAAACAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_145262.2-1063s1c1
Sequence:CCGGGCAGCCATGCAAGGTGATGTACTCGAGTACATCACCTTGCATGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_145262.2-1501s1c1
Sequence:CCGGGCCACCTTCCTAGCCCACAATCTCGAGATTGTGGGCTAGGAAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145262.2-232s1c1
Sequence:CCGGGCACTATCCTTGGACCCTGGTCTCGAGACCAGGGTCCAAGGATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145262.2-979s1c1
Sequence:CCGGGTGATCATTGGCTCTAATGTGCTCGAGCACATTAGAGCCAATGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145262.2-901s1c1
Sequence:CCGGCCACGTTCTGTGAAGACTGTGCTCGAGCACAGTCTTCACAGAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219758    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145262.2-1779s1c1
Sequence:CCGGTCAGGGCCTCTGCTCTATATCCTCGAGGATATAGAGCAGAGGCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219757    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145262.2-1744s1c1
Sequence:CCGGTGGCCTTGGCTGTTTGGTTAACTCGAGTTAACCAAACAGCCAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145262
VALIDATED
GLYCTK MISSION shRNA shRNA Plasmid DNA
glycerate kinase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145262.2-861s1c1
Sequence:CCGGCCTGCATATCCTCAATCGCTACTCGAGTAGCGATTGAGGATATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145262.2-1510s1c1
Sequence:CCGGCTAGCCCACAATGACTCACATCTCGAGATGTGAGTCATTGTGGGCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145262.2-178s1c1
Sequence:CCGGCAGCTGTTTGAGAGTGCTGTACTCGAGTACAGCACTCTCAAACAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_145262.2-1063s1c1
Sequence:CCGGGCAGCCATGCAAGGTGATGTACTCGAGTACATCACCTTGCATGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_145262.2-1501s1c1
Sequence:CCGGGCCACCTTCCTAGCCCACAATCTCGAGATTGTGGGCTAGGAAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145262.2-232s1c1
Sequence:CCGGGCACTATCCTTGGACCCTGGTCTCGAGACCAGGGTCCAAGGATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145262.2-979s1c1
Sequence:CCGGGTGATCATTGGCTCTAATGTGCTCGAGCACATTAGAGCCAATGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145262.2-901s1c1
Sequence:CCGGCCACGTTCTGTGAAGACTGTGCTCGAGCACAGTCTTCACAGAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219758    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145262.2-1779s1c1
Sequence:CCGGTCAGGGCCTCTGCTCTATATCCTCGAGGATATAGAGCAGAGGCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219757    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145262.2-1744s1c1
Sequence:CCGGTGGCCTTGGCTGTTTGGTTAACTCGAGTTAACCAAACAGCCAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145262
VALIDATED
GLYCTK MISSION shRNA Lentiviral Transduction Particles
glycerate kinase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145262.2-861s1c1
Sequence:CCGGCCTGCATATCCTCAATCGCTACTCGAGTAGCGATTGAGGATATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145262.2-1510s1c1
Sequence:CCGGCTAGCCCACAATGACTCACATCTCGAGATGTGAGTCATTGTGGGCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145262.2-178s1c1
Sequence:CCGGCAGCTGTTTGAGAGTGCTGTACTCGAGTACAGCACTCTCAAACAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_145262.2-1063s1c1
Sequence:CCGGGCAGCCATGCAAGGTGATGTACTCGAGTACATCACCTTGCATGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_145262.2-1501s1c1
Sequence:CCGGGCCACCTTCCTAGCCCACAATCTCGAGATTGTGGGCTAGGAAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145262.2-232s1c1
Sequence:CCGGGCACTATCCTTGGACCCTGGTCTCGAGACCAGGGTCCAAGGATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145262.2-979s1c1
Sequence:CCGGGTGATCATTGGCTCTAATGTGCTCGAGCACATTAGAGCCAATGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145262.2-901s1c1
Sequence:CCGGCCACGTTCTGTGAAGACTGTGCTCGAGCACAGTCTTCACAGAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219758    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145262.2-1779s1c1
Sequence:CCGGTCAGGGCCTCTGCTCTATATCCTCGAGGATATAGAGCAGAGGCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219757    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145262.2-1744s1c1
Sequence:CCGGTGGCCTTGGCTGTTTGGTTAACTCGAGTTAACCAAACAGCCAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174846
GLYCTK MISSION shRNA Bacterial Glycerol Stock
glycerate kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174846.3-948s1c1
Sequence:CCGGCCTCATCTTGTCAGATGTGATCTCGAGATCACATCTGACAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174846.3-3584s1c1
Sequence:CCGGGCAAACAGTTTGTGGGCATAACTCGAGTTATGCCCACAAACTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174846.3-1683s1c1
Sequence:CCGGCCTCACCAACAACGACTCATACTCGAGTATGAGTCGTTGTTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174846.3-926s1c1
Sequence:CCGGCCTATCCTGCTCAGGTGATAACTCGAGTTATCACCTGAGCAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174846.3-1689s1c1
Sequence:CCGGCAACAACGACTCATACACTTTCTCGAGAAAGTGTATGAGTCGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174846.4-2294s21c1
Sequence:CCGGGCCAGTACCTTGAAGAGTTTCCTCGAGGAAACTCTTCAAGGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174846.4-1063s21c1
Sequence:CCGGGTGCAAGACTGCCTGCATATTCTCGAGAATATGCAGGCAGTCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174846.4-1791s21c1
Sequence:CCGGGTTGACAGGGACCAATGTTATCTCGAGATAACATTGGTCCCTGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174846
GLYCTK MISSION shRNA shRNA Plasmid DNA
glycerate kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174846.3-948s1c1
Sequence:CCGGCCTCATCTTGTCAGATGTGATCTCGAGATCACATCTGACAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174846.3-3584s1c1
Sequence:CCGGGCAAACAGTTTGTGGGCATAACTCGAGTTATGCCCACAAACTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174846.3-1683s1c1
Sequence:CCGGCCTCACCAACAACGACTCATACTCGAGTATGAGTCGTTGTTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174846.3-926s1c1
Sequence:CCGGCCTATCCTGCTCAGGTGATAACTCGAGTTATCACCTGAGCAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174846.3-1689s1c1
Sequence:CCGGCAACAACGACTCATACACTTTCTCGAGAAAGTGTATGAGTCGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174846.4-2294s21c1
Sequence:CCGGGCCAGTACCTTGAAGAGTTTCCTCGAGGAAACTCTTCAAGGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174846.4-1063s21c1
Sequence:CCGGGTGCAAGACTGCCTGCATATTCTCGAGAATATGCAGGCAGTCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174846.4-1791s21c1
Sequence:CCGGGTTGACAGGGACCAATGTTATCTCGAGATAACATTGGTCCCTGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174846
GLYCTK MISSION shRNA Lentiviral Transduction Particles
glycerate kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174846.3-948s1c1
Sequence:CCGGCCTCATCTTGTCAGATGTGATCTCGAGATCACATCTGACAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174846.3-3584s1c1
Sequence:CCGGGCAAACAGTTTGTGGGCATAACTCGAGTTATGCCCACAAACTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174846.3-1683s1c1
Sequence:CCGGCCTCACCAACAACGACTCATACTCGAGTATGAGTCGTTGTTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174846.3-926s1c1
Sequence:CCGGCCTATCCTGCTCAGGTGATAACTCGAGTTATCACCTGAGCAGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174846.3-1689s1c1
Sequence:CCGGCAACAACGACTCATACACTTTCTCGAGAAAGTGTATGAGTCGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174846.4-2294s21c1
Sequence:CCGGGCCAGTACCTTGAAGAGTTTCCTCGAGGAAACTCTTCAAGGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174846.4-1063s21c1
Sequence:CCGGGTGCAAGACTGCCTGCATATTCTCGAGAATATGCAGGCAGTCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174846.4-1791s21c1
Sequence:CCGGGTTGACAGGGACCAATGTTATCTCGAGATAACATTGGTCCCTGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks