EMAIL THIS PAGE TO A FRIEND

GLYR1

glyoxylate reductase 1 homolog (Arabidopsis)

116 Gene Product Result for
Synonyms: BM045 HIBDL N-PAC NP60
Gene ID:
Mouse(74022) glyoxylate reductase 1 homolog (Arabidopsis)
Rat(360477) glyoxylate reductase 1 homolog (Arabidopsis)
Zebrafish(493611) glyoxylate reductase 1 homolog (Arabidopsis)
cow(539636) glyoxylate reductase 1 homolog (Arabidopsis)
Horse(100069922) glyoxylate reductase 1 homolog (Arabidopsis)
domestic cat(101092478) glyoxylate reductase 1 homolog (Arabidopsis)
dog(479860) glyoxylate reductase 1 homolog (Arabidopsis)
chicken(426988) glyoxylate reductase 1 homolog (Arabidopsis)
Thale Cress(822139) gamma-hydroxybutyrate dehydrogenase
domestic guinea pig(100721930) glyoxylate reductase 1 homolog (Arabidopsis)
naked mole-rat(101701941) glyoxylate reductase 1 homolog (Arabidopsis)
sheep(101103778) glyoxylate reductase 1 homolog (Arabidopsis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032569 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032569 Rosetta Predictions human pricing
NM_001007800 Rosetta Predictions rat pricing
NM_001079814 Rosetta Predictions mouse pricing
NM_028720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116795 predicted 1409
2 SASI_Hs01_00116796 predicted 344
3 SASI_Hs01_00116797 predicted 611
4 SASI_Hs01_00116798 predicted 1586
5 SASI_Hs01_00116799 predicted 380
6 SASI_Hs01_00116800 predicted 1498
7 SASI_Hs01_00116801 predicted 797
8 SASI_Hs01_00116802 predicted 342
9 SASI_Hs01_00116803 predicted 369
10 SASI_Hs01_00116804 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007800 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107111 predicted 330
2 SASI_Rn01_00107112 predicted 1296
3 SASI_Rn01_00107113 predicted 285
4 SASI_Rn01_00107114 predicted 357
5 SASI_Rn01_00107115 predicted 684
6 SASI_Rn01_00107116 predicted 567
7 SASI_Rn01_00107117 predicted 352
8 SASI_Rn01_00107118 predicted 1162
9 SASI_Rn01_00107119 predicted 686
10 SASI_Rn01_00107120 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293052 predicted 390
2 SASI_Mm02_00293053 predicted 1360
3 SASI_Mm02_00293054 predicted 259
4 SASI_Mm02_00293055 predicted 1241
5 SASI_Mm02_00293056 predicted 421
6 SASI_Mm02_00293057 predicted 1586
7 SASI_Mm02_00293058 predicted 225
8 SASI_Mm02_00293059 predicted 223
9 SASI_Mm02_00293060 predicted 686
10 SASI_Mm02_00293061 predicted 1473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042044 predicted 394
2 SASI_Mm01_00042043 predicted 1346
3 SASI_Mm01_00042045 predicted 257
4 SASI_Mm01_00042046 predicted 1226
5 SASI_Mm01_00042047 predicted 421
6 SASI_Mm01_00042048 predicted 1569
7 SASI_Mm02_00334274 predicted 227
8 SASI_Mm02_00334275 predicted 226
9 SASI_Mm01_00042051 predicted 687
10 SASI_Mm02_00334276 predicted 1446
11 SASI_Mm01_00042049 predicted 789
12 SASI_Mm01_00042050 predicted 700
13 SASI_Mm01_00042052 predicted 1478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032569
GLYR1 MISSION shRNA Bacterial Glycerol Stock
glyoxylate reductase 1 homolog (Arabidopsis)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032569.3-1371s21c1
Sequence:CCGGGGAGCTTCATGGCCACTATTGCTCGAGCAATAGTGGCCATGAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032569.3-327s21c1
Sequence:CCGGACCAGACGTCATCCCACAATTCTCGAGAATTGTGGGATGACGTCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032569.3-1648s21c1
Sequence:CCGGGGACCAGTCTGACAACGATATCTCGAGATATCGTTGTCAGACTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032569.2-714s1c1
Sequence:CCGGCCAGGCAATCACGAAGAAGTTCTCGAGAACTTCTTCGTGATTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032569.2-397s1c1
Sequence:CCGGCGCAAACTTAGCCTGTCTGAACTCGAGTTCAGACAGGCTAAGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032569.2-127s1c1
Sequence:CCGGCGCGGAAAGAAATGCTTCTTTCTCGAGAAAGAAGCATTTCTTTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032569.2-1503s1c1
Sequence:CCGGGCCTGATTTCTACCTGAAATACTCGAGTATTTCAGGTAGAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032569.2-1594s1c1
Sequence:CCGGGCAGCAAATGAGGTGTACAAACTCGAGTTTGTACACCTCATTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032569
GLYR1 MISSION shRNA shRNA Plasmid DNA
glyoxylate reductase 1 homolog (Arabidopsis)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032569.3-1371s21c1
Sequence:CCGGGGAGCTTCATGGCCACTATTGCTCGAGCAATAGTGGCCATGAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032569.3-327s21c1
Sequence:CCGGACCAGACGTCATCCCACAATTCTCGAGAATTGTGGGATGACGTCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032569.3-1648s21c1
Sequence:CCGGGGACCAGTCTGACAACGATATCTCGAGATATCGTTGTCAGACTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032569.2-714s1c1
Sequence:CCGGCCAGGCAATCACGAAGAAGTTCTCGAGAACTTCTTCGTGATTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032569.2-397s1c1
Sequence:CCGGCGCAAACTTAGCCTGTCTGAACTCGAGTTCAGACAGGCTAAGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032569.2-127s1c1
Sequence:CCGGCGCGGAAAGAAATGCTTCTTTCTCGAGAAAGAAGCATTTCTTTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032569.2-1503s1c1
Sequence:CCGGGCCTGATTTCTACCTGAAATACTCGAGTATTTCAGGTAGAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032569.2-1594s1c1
Sequence:CCGGGCAGCAAATGAGGTGTACAAACTCGAGTTTGTACACCTCATTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032569
GLYR1 MISSION shRNA Lentiviral Transduction Particles
glyoxylate reductase 1 homolog (Arabidopsis)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032569.3-1371s21c1
Sequence:CCGGGGAGCTTCATGGCCACTATTGCTCGAGCAATAGTGGCCATGAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032569.3-327s21c1
Sequence:CCGGACCAGACGTCATCCCACAATTCTCGAGAATTGTGGGATGACGTCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032569.3-1648s21c1
Sequence:CCGGGGACCAGTCTGACAACGATATCTCGAGATATCGTTGTCAGACTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032569.2-714s1c1
Sequence:CCGGCCAGGCAATCACGAAGAAGTTCTCGAGAACTTCTTCGTGATTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032569.2-397s1c1
Sequence:CCGGCGCAAACTTAGCCTGTCTGAACTCGAGTTCAGACAGGCTAAGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032569.2-127s1c1
Sequence:CCGGCGCGGAAAGAAATGCTTCTTTCTCGAGAAAGAAGCATTTCTTTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032569.2-1503s1c1
Sequence:CCGGGCCTGATTTCTACCTGAAATACTCGAGTATTTCAGGTAGAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032569.2-1594s1c1
Sequence:CCGGGCAGCAAATGAGGTGTACAAACTCGAGTTTGTACACCTCATTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028720
VALIDATED
GLYR1 MISSION shRNA Bacterial Glycerol Stock
glyoxylate reductase 1 homolog (Arabidopsis)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028720.2-1657s1c1
Sequence:CCGGGGACCAGTCTGACAATGATATCTCGAGATATCATTGTCAGACTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028720.2-646s21c1
Sequence:CCGGTGGACCGATGGCTGCATTTAACTCGAGTTAAATGCAGCCATCGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028720.2-384s21c1
Sequence:CCGGATGACAAGAATCGGCGTAATTCTCGAGAATTACGCCGATTCTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241372    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028720.2-2595s21c1
Sequence:CCGGAGCCTGATCAACACCAATAATCTCGAGATTATTGGTGTTGATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028720.2-527s21c1
Sequence:CCGGAGAGGCTCCAAATGCCTTAAACTCGAGTTTAAGGCATTTGGAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028720.2-279s21c1
Sequence:CCGGTAAAGATTAACAAGGGTAAACCTCGAGGTTTACCCTTGTTAATCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191376    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028720.1-2924s1c1
Sequence:CCGGCGGTTAGTCAATGTTGTCTTACTCGAGTAAGACAACATTGACTAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028720
VALIDATED
GLYR1 MISSION shRNA shRNA Plasmid DNA
glyoxylate reductase 1 homolog (Arabidopsis)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028720.2-1657s1c1
Sequence:CCGGGGACCAGTCTGACAATGATATCTCGAGATATCATTGTCAGACTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028720.2-646s21c1
Sequence:CCGGTGGACCGATGGCTGCATTTAACTCGAGTTAAATGCAGCCATCGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028720.2-384s21c1
Sequence:CCGGATGACAAGAATCGGCGTAATTCTCGAGAATTACGCCGATTCTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241372    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028720.2-2595s21c1
Sequence:CCGGAGCCTGATCAACACCAATAATCTCGAGATTATTGGTGTTGATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028720.2-527s21c1
Sequence:CCGGAGAGGCTCCAAATGCCTTAAACTCGAGTTTAAGGCATTTGGAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028720.2-279s21c1
Sequence:CCGGTAAAGATTAACAAGGGTAAACCTCGAGGTTTACCCTTGTTAATCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191376    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028720.1-2924s1c1
Sequence:CCGGCGGTTAGTCAATGTTGTCTTACTCGAGTAAGACAACATTGACTAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028720
VALIDATED
GLYR1 MISSION shRNA Lentiviral Transduction Particles
glyoxylate reductase 1 homolog (Arabidopsis)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028720.2-1657s1c1
Sequence:CCGGGGACCAGTCTGACAATGATATCTCGAGATATCATTGTCAGACTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028720.2-646s21c1
Sequence:CCGGTGGACCGATGGCTGCATTTAACTCGAGTTAAATGCAGCCATCGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028720.2-384s21c1
Sequence:CCGGATGACAAGAATCGGCGTAATTCTCGAGAATTACGCCGATTCTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241372    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028720.2-2595s21c1
Sequence:CCGGAGCCTGATCAACACCAATAATCTCGAGATTATTGGTGTTGATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028720.2-527s21c1
Sequence:CCGGAGAGGCTCCAAATGCCTTAAACTCGAGTTTAAGGCATTTGGAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028720.2-279s21c1
Sequence:CCGGTAAAGATTAACAAGGGTAAACCTCGAGGTTTACCCTTGTTAATCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191376    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028720.1-2924s1c1
Sequence:CCGGCGGTTAGTCAATGTTGTCTTACTCGAGTAAGACAACATTGACTAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks